Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000263.4(NAGLU):c.82_114del (p.Glu28_Arg38del)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Feb 6, 2020)
Last evaluated:
Jul 18, 2019
Accession:
VCV000962915.1
Variation ID:
962915
Description:
33bp deletion
Help

NM_000263.4(NAGLU):c.82_114del (p.Glu28_Arg38del)

Allele ID
949921
Variant type
Deletion
Variant length
33 bp
Cytogenetic location
17q21.2
Genomic location
17: 42536347-42536379 (GRCh38) GRCh38 UCSC
17: 40688365-40688397 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000017.10:g.40688372_40688404del
NC_000017.11:g.42536354_42536386del
NG_011552.1:g.5422_5454del
NM_000263.4:c.82_114del MANE Select NP_000254.2:p.Glu28_Arg38del
Protein change
-
Other names
-
Canonical SPDI
NC_000017.11:42536346:GGCCCGGGAGGCGGCGGCCGTGCGGGCGCTCGTGGCCCGG:GGCCCGG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs2092905949
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter Jul 18, 2019 RCV001236855.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
NAGLU - - GRCh38
GRCh37
462 474

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Jul 18, 2019)
criteria provided, single submitter
Method: clinical testing
Charcot-Marie-Tooth disease, axonal type 2V
Mucopolysaccharidosis, MPS-III-B
Allele origin: germline
Invitae
Accession: SCV001409593.1
Submitted: (Feb 06, 2020)
Evidence details
Comment:
This variant, c.82_114del, results in the deletion of 11 amino acid(s) of the NAGLU protein (p.Glu28_Arg38del), but otherwise preserves the integrity of the reading frame. … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs2092905949...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021