Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000441.2(SLC26A4):c.1343_1355dup (p.Val453fs)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 7, 2021)
Last evaluated:
Apr 24, 2019
Accession:
VCV000949322.2
Variation ID:
949322
Description:
13bp duplication
Help

NM_000441.2(SLC26A4):c.1343_1355dup (p.Val453fs)

Allele ID
924578
Variant type
Duplication
Variant length
13 bp
Cytogenetic location
7q22.3
Genomic location
7: 107694621-107694622 (GRCh38) GRCh38 UCSC
7: 107335066-107335067 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000007.13:g.107335067_107335079dup
NC_000007.14:g.107694622_107694634dup
NM_000441.2:c.1343_1355dup MANE Select NP_000432.1:p.Val453fs frameshift
NG_008489.1:g.38988_39000dup
Protein change
V453fs
Other names
-
Canonical SPDI
NC_000007.14:107694621:CGGTCTTGGCAGC:CGGTCTTGGCAGCCGGTCTTGGCAGC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Apr 24, 2019 RCV001220758.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
SLC26A4 - - GRCh38
GRCh37
748 824

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Apr 24, 2019)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
Invitae
Accession: SCV001392768.2
Submitted: (Jan 07, 2021)
Evidence details
Publications
PubMed (4)
Comment:
This sequence change creates a premature translational stop signal (p.Val453Glyfs*19) in the SLC26A4 gene. It is expected to result in an absent or disrupted protein … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Characterising the spectrum of autosomal recessive hereditary hearing loss in Iran. Sloan-Heggen CM Journal of medical genetics 2015 PMID: 26445815
Mutation Spectrum of Common Deafness-Causing Genes in Patients with Non-Syndromic Deafness in the Xiamen Area, China. Jiang Y PloS one 2015 PMID: 26252218
Evaluation of genotype-phenotype relationships in patients referred for endocrine assessment in suspected Pendred syndrome. Soh LM European journal of endocrinology 2015 PMID: 25394566
Assessment of the genetic causes of recessive childhood non-syndromic deafness in the UK - implications for genetic testing. Hutchin T Clinical genetics 2005 PMID: 16283880

Record last updated May 10, 2021