Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001854.4(COL11A1):c.1792-39ATG[9]

Help
Interpretation:
Benign/Likely benign​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
9 (Most recent: Sep 21, 2021)
Last evaluated:
Jul 22, 2021
Accession:
VCV000093966.4
Variation ID:
93966
Description:
3bp microsatellite
Help

NM_001854.4(COL11A1):c.1792-39ATG[9]

Allele ID
99868
Variant type
Microsatellite
Variant length
3 bp
Cytogenetic location
1p21.1
Genomic location
1: 103005901-103005903 (GRCh38) GRCh38 UCSC
1: 103471457-103471459 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NM_080629.2:c.1828-12_1828-10delATG
NC_000001.10:g.103471459TCA[9]
NC_000001.11:g.103005903TCA[9]
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000001.11:103005900:CATCATCATCATCATCATCATCATCATCATCA:CATCATCATCATCATCATCATCATCATCA
Functional consequence
-
Global minor allele frequency (GMAF)
0.44888 (CATCATCATCATCATCATCATCATCATCATCA)

Allele frequency
-
Links
ClinGen: CA147518
dbSNP: rs71752747
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Benign/Likely benign 3 criteria provided, multiple submitters, no conflicts Mar 29, 2016 RCV000079905.6
Benign 2 criteria provided, multiple submitters, no conflicts Dec 8, 2020 RCV001510954.2
Benign 1 criteria provided, single submitter Jul 22, 2021 RCV001582568.1
Benign 1 criteria provided, single submitter Jul 22, 2021 RCV001582566.1
Benign 1 criteria provided, single submitter Jul 22, 2021 RCV001582565.1
Benign 1 criteria provided, single submitter Jul 22, 2021 RCV001582567.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
COL11A1 Little evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
997 1023

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely benign
(-)
criteria provided, single submitter
Method: clinical testing
NOT SPECIFIED
Allele origin: germline
PreventionGenetics,PreventionGenetics
Accession: SCV000308445.1
Submitted: (Apr 28, 2016)
Evidence details
Benign
(Mar 29, 2016)
criteria provided, single submitter
Method: clinical testing
not specified
Allele origin: germline
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine
Accession: SCV000538711.1
Submitted: (Apr 03, 2017)
Evidence details
Comment:
Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or … (more)
Benign
(May 05, 2014)
criteria provided, single submitter
Method: clinical testing
not specified
Allele origin: germline
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics
Accession: SCV000111788.8
Submitted: (Sep 19, 2018)
Evidence details
Other databases
http://www.egl-eurofins.com/emvc…
Benign
(Dec 08, 2020)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
Invitae
Accession: SCV001718119.1
Submitted: (Jan 07, 2021)
Evidence details
Benign
(Jul 22, 2021)
criteria provided, single submitter
Method: clinical testing
Deafness, autosomal dominant 37
Allele origin: germline
Nilou-Genome Lab
Accession: SCV001821635.1
Submitted: (Sep 01, 2021)
Evidence details
Benign
(Jul 22, 2021)
criteria provided, single submitter
Method: clinical testing
Fibrochondrogenesis 1
Allele origin: germline
Nilou-Genome Lab
Accession: SCV001821636.1
Submitted: (Sep 01, 2021)
Evidence details
Benign
(Jul 22, 2021)
criteria provided, single submitter
Method: clinical testing
Marshall syndrome
Allele origin: germline
Nilou-Genome Lab
Accession: SCV001821637.1
Submitted: (Sep 01, 2021)
Evidence details
Benign
(Jul 22, 2021)
criteria provided, single submitter
Method: clinical testing
Stickler syndrome type 2
Allele origin: germline
Nilou-Genome Lab
Accession: SCV001821638.1
Submitted: (Sep 01, 2021)
Evidence details
Benign
(Sep 30, 2016)
criteria provided, single submitter
Method: clinical testing
Not Provided
Allele origin: germline
GeneDx
Accession: SCV001907687.1
Submitted: (Sep 21, 2021)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=COL11A1 - - - -

Text-mined citations for rs71752747...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021