Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001079668.3(NKX2-1):c.278_306del (p.Ala93fs)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Mar 6, 2020)
Last evaluated:
Jan 10, 2020
Accession:
VCV000932917.1
Variation ID:
932917
Description:
29bp deletion
Help

NM_001079668.3(NKX2-1):c.278_306del (p.Ala93fs)

Allele ID
921217
Variant type
Deletion
Variant length
29 bp
Cytogenetic location
14q13.3
Genomic location
14: 36519142-36519170 (GRCh38) GRCh38 UCSC
14: 36988347-36988375 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000014.9:g.36519148_36519176del
NC_000014.8:g.36988353_36988381del
NM_001079668.3:c.278_306del MANE Select NP_001073136.1:p.Ala93fs frameshift
... more HGVS
Protein change
A63fs, A93fs
Other names
-
Canonical SPDI
NC_000014.9:36519141:CGCCGTCATGTGGTAGGCGGCGGTGACGGCGCCGT:CGCCGT
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Jan 10, 2020 RCV001200886.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
NKX2-1 - - GRCh38
GRCh37
1 163
SFTA3 - - GRCh38
GRCh37
- 151

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Jan 10, 2020)
criteria provided, single submitter
Method: clinical testing
Choreoathetosis, hypothyroidism, and neonatal respiratory distress
Allele origin: germline
Johns Hopkins Genomics, Johns Hopkins University
Accession: SCV001371791.1
Submitted: (Mar 06, 2020)
Evidence details
Publications
PubMed (1)
Comment:
This frameshift variant is predicted to lead to a new stop codon that is downstream of the native stop codon. The resulting transcript is not … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Physical and functional interactions between homeodomain NKX2.1 and winged helix/forkhead FOXA1 in lung epithelial cells. Minoo P Molecular and cellular biology 2007 PMID: 17220277

Record last updated Feb 27, 2021