Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

MSH6:c.3647-51_3647-35del17

Help
Interpretation:
Likely benign​

Review status:
reviewed by expert panel
Submissions:
5 (Most recent: Sep 18, 2021)
Last evaluated:
Sep 5, 2013
Accession:
VCV000089436.3
Variation ID:
89436
Description:
17bp microsatellite
Help

MSH6:c.3647-51_3647-35del17

Allele ID
94910
Variant type
Microsatellite
Variant length
17 bp
Cytogenetic location
2p16.3
Genomic location
2: 47806134-47806150 (GRCh38) GRCh38 UCSC
2: 48033273-48033289 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_219t1:c.3647-51_3647-35del
NM_000179.2:c.3647-68_3647-52delTTTGTTTTAATTCCTTT
NC_000002.11:g.48033275_48033291TTTGTTTTAATTCCTTT[1]
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000002.12:47806133:TTTTTGTTTTAATTCCTTTTTTGTTTTAATTCCTTT:TTTTTGTTTTAATTCCTTT
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA210400
dbSNP: rs267607687
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely benign 2 reviewed by expert panel Sep 5, 2013 RCV000074904.3
Benign 1 criteria provided, single submitter Jun 23, 2018 RCV001675601.2
Benign 2 no assertion criteria provided - RCV000202136.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
MSH6 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
5637 5671

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely benign
(Sep 05, 2013)
reviewed by expert panel
Method: research
Lynch Syndrome
Allele origin: germline
International Society for Gastrointestinal Hereditary Tumours (InSiGHT)
Accession: SCV000108116.2
Submitted: (Dec 18, 2013)
Comment:
Classified with v1.9 guidelines: https://docs.google.com/file/d/0B3JL6rP6JzhoN2EydHRVMEI1UGs
Evidence details
Comment:
Intronic variant with no effect on splicing & MAF 0.01-1%
Benign
(Jun 23, 2018)
criteria provided, single submitter
Method: clinical testing
Not Provided
Allele origin: germline
GeneDx
Accession: SCV001895254.1
Submitted: (Sep 18, 2021)
Evidence details
Benign
(-)
no assertion criteria provided
Method: research
not specified
Allele origin: unknown
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV000257271.1
Submitted: (Nov 19, 2015)
Evidence details
Benign
(-)
no assertion criteria provided
Method: research
not specified
Allele origin: unknown
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV000257272.1
Submitted: (Nov 19, 2015)
Evidence details
Benign
(Jan 06, 2011)
no assertion criteria provided
Method: clinical testing
Lynch syndrome
Allele origin: germline
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000052936.2
Submitted: (Nov 20, 2015)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Text-mined citations for rs267607687...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 23, 2021