Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001110556.2(FLNA):c.4750_4755+18del

Help
Interpretation:
Pathogenic/Likely pathogenic​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
2 (Most recent: Jul 4, 2021)
Last evaluated:
Aug 1, 2018
Accession:
VCV000871720.7
Variation ID:
871720
Description:
24bp deletion
Help

NM_001110556.2(FLNA):c.4750_4755+18del

Allele ID
860809
Variant type
Deletion
Variant length
24 bp
Cytogenetic location
Xq28
Genomic location
X: 154358181-154358204 (GRCh38) GRCh38 UCSC
X: 153586549-153586572 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_1340:g.21435_21458del
LRG_1340t1:c.4750_4755+18del
NC_000023.10:g.153586550_153586573del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000023.11:154358180:CCTGTGCCCGGAGCTCACCGTGATC:C
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Aug 1, 2018 RCV001091829.2
Likely pathogenic 1 criteria provided, single submitter Jul 27, 2018 RCV001253331.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
FLNA Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
1486 1809

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Jul 27, 2018)
criteria provided, single submitter
Method: clinical testing
Cardiac valvular dysplasia, X-linked
Allele origin: germline
Institute of Human Genetics, University of Leipzig Medical Center
Accession: SCV001428991.1
Submitted: (Apr 20, 2020)
Evidence details
Pathogenic
(Aug 01, 2018)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
CeGaT Praxis fuer Humangenetik Tuebingen
Accession: SCV001248062.6
Submitted: (Jul 04, 2021)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Oct 07, 2021