Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000075.4(CDK4):c.549_567del (p.Glu184fs)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 7, 2021)
Last evaluated:
May 11, 2020
Accession:
VCV000860503.2
Variation ID:
860503
Description:
19bp deletion
Help

NM_000075.4(CDK4):c.549_567del (p.Glu184fs)

Allele ID
840169
Variant type
Deletion
Variant length
19 bp
Cytogenetic location
12q14.1
Genomic location
12: 57750721-57750739 (GRCh38) GRCh38 UCSC
12: 58144504-58144522 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_490:g.6643_6661del
NC_000012.11:g.58144507_58144525del
NC_000012.12:g.57750724_57750742del
... more HGVS
Protein change
E184fs
Other names
-
Canonical SPDI
NC_000012.12:57750720:GGACTGCAGAAGAACTTCGGGA:GGA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter May 11, 2020 RCV001066817.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
CDK4 No evidence available No evidence available GRCh38
GRCh37
341 563

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(May 11, 2020)
criteria provided, single submitter
Method: clinical testing
Hereditary melanoma
Allele origin: germline
Invitae
Accession: SCV001231837.2
Submitted: (Jan 07, 2021)
Evidence details
Comment:
This sequence change creates a premature translational stop signal (p.Glu184Hisfs*40) in the CDK4 gene. It is expected to result in an absent or disrupted protein … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Oct 08, 2021