NM_000256.3(MYBPC3):c.3742_3759dup (p.Gly1248_Cys1253dup)
criteria provided, multiple submitters, no conflicts. Learn more about how ClinVar calculates review status.
Pathogenic (11); Likely pathogenic (1)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000256.3(MYBPC3):c.3742_3759dup (p.Gly1248_Cys1253dup)
Variation ID: 8603 Accession: VCV000008603.47
- Type and length
-
Duplication, 18 bp
- Location
-
Cytogenetic: 11p11.2 11: 47332126-47332127 (GRCh38) [ NCBI UCSC ] 11: 47353677-47353678 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 4, 2013 Aug 4, 2026 Jan 28, 2026 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000256.3:c.3742_3759dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000247.2:p.Gly1248_Cys1253dup inframe insertion NM_000256.3:c.3742_3759dup18 MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
inframe insertion NM_000256.3:c.3742_3759dupGGGGGCATCTATGTCTGC MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
inframe insertion NC_000011.10:g.47332128_47332145dup NC_000011.9:g.47353679_47353696dup NG_007667.1:g.25559_25576dup LRG_386:g.25559_25576dup LRG_386t1:c.3742_3759dup LRG_386p1:p.Gly1248_Cys1253dup - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000011.10:47332126:GCAGACATAGATGCCCCCG:GCAGACATAGATGCCCCCGCAGACATAGATGCCCCCG
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MYBPC3 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
4727 | 4749 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
no assertion criteria provided
|
Dec 1, 1995 | RCV000009134.15 | |
| Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Jul 5, 2021 | RCV000030290.14 | |
| Pathogenic/Likely pathogenic (4) |
criteria provided, multiple submitters, no conflicts
|
Mar 29, 2022 | RCV000223778.24 | |
| Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Jan 28, 2026 | RCV000463609.26 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Sep 12, 2025 | RCV000620220.12 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Jul 7, 2025 | RCV001181534.14 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Jun 12, 2024 | RCV002490342.9 | |
| not provided (2) |
no classification provided
|
- | RCV002508917.11 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
Expand all rows
Collapse all rows
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(-)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Primary familial hypertrophic cardiomyopathy |
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute
Accession: SCV000987509.1
First in ClinVar: Sep 08, 2019 Last updated: Sep 08, 2019 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
|
|
|
Pathogenic
(Apr 08, 2019)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV001713559.1
First in ClinVar: Jun 15, 2021 Last updated: Jun 15, 2021 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Number of individuals with the variant: 1
|
|
|
Pathogenic
(Mar 25, 2024)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Hypertrophic cardiomyopathy
(Autosomal dominant inheritance)
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV000203962.5
First in ClinVar: Apr 04, 2013 Last updated: Apr 20, 2024 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Sep 12, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Cardiovascular phenotype |
Ambry Genetics
Accession: SCV000737356.6
First in ClinVar: Apr 14, 2018 Last updated: Oct 05, 2025 |
Comment:
show
The c.3742_3759dup18 pathogenic mutation (also known as p.G1248_C1253dup) is located in coding exon 33 of the MYBPC3 gene. This variant results from an in-frame duplication of 18 nucleotides at positions 3742 to 3759. This results in the duplication of six residues between codons 1248 and 1253. This alteration (also referred to as an 18bp tandem duplication of residues 3774-3791 and ins18bp1163) has been detected in multiple individuals reported to have hypertrophic cardiomyopathy and has been reported to segregate with disease in at least one family (Watkins H et al. Nat Genet. 1995;11:434-7; Maron BJ et al. J Am Coll Cardiol. 2001 Aug;38:315-21; Helms AS et al. Circ Cardiovasc Genet. 2014;7:434-43; Kapplinger JD et al. J Cardiovasc Transl Res. 2014;7:347-61). Functional studies performed in vitro and ex vivo suggest that this duplication results in a mislocalized, unstable protein subject to rapid degradation (Helms AS et al. Circ Cardiovasc Genet. 2014;7:434-43; Glazier AA et al. JCI Insight 2018 Jun;3(11)). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Jan 28, 2026)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Hypertrophic cardiomyopathy |
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000546482.12
First in ClinVar: Apr 17, 2017 Last updated: Feb 15, 2026 |
Comment:
show
This variant, c.3742_3759dup, results in the insertion of 6 amino acid(s) of the MYBPC3 protein (p.Gly1248_Cys1253dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with hypertrophic cardiomyopathy (PMID: 7493025, 20474083, 23549607, 24510615, 27532257). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 8603). Algorithms developed to predict the effect of variants on gene product structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects MYBPC3 function (PMID: 12202917, 25031304). For these reasons, this variant has been classified as Pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Jul 05, 2021)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Primary familial hypertrophic cardiomyopathy |
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000052957.3
First in ClinVar: Apr 04, 2013 Last updated: Jul 10, 2021 |
Comment:
show
Variant summary: MYBPC3 c.3742_3759dup18 (p.Gly1248_Cys1253dup) results in an in-frame duplication that is predicted to duplicate six amino acids into the encoded protein. The variant was absent in 250026 control chromosomes. c.3742_3759dup18 has been reported in the literature in multiple individuals affected with Hypertrophic Cardiomyopathy (e.g. Watkins_1995, Ho_2013, Helms_2014). These data indicate that the variant is very likely to be associated with disease. Experimental evidence suggests that the variant has an effect on protein stability (e.g. Brown_2002, Helms_2014).. Six other clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Mar 02, 2021)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV002049332.1
First in ClinVar: Jan 08, 2022 Last updated: Jan 08, 2022 |
Comment:
show
The MYBPC3 c.3742_3759dup; p.Gly1248_Cys1253dup variant (rs193922384), also published as ins18bp1163, is reported in the literature in multiple individuals and families affected with hypertrophic cardiomyopathy or dilated cardiomyopathy (Helms 2014, Maron 2001, Kapplinger 2014, Watkins 1995, Zimmerman 2010). The variant was observed to co-segregate with disease in at least one large kindred (Watkins 1995). This variant is absent from general population databases (Exome Variant Server, Genome Aggregation Database), indicating it is not a common polymorphism. This variant duplicates six amino acid residues, leaving the rest of the protein in-frame. Functional studies from multiple groups suggest the variant protein is unstable relative to the wildtype protein (Brown 2002, Glazier 2018, Helms 2014). Based on available information, this variant is considered to be pathogenic. References: Brown LJ et al. Functional and spectroscopic studies of a familial hypertrophic cardiomyopathy mutation in Motif X of cardiac myosin binding protein-C. Eur Biophys J. 2002 Sep;31(5):400-8. Glazier AA et al. HSC70 is a chaperone for wild-type and mutant cardiac myosin binding protein C. JCI Insight. 2018 Jun 7;3(11):e99319. Helms AS et al. Sarcomere mutation-specific expression patterns in human hypertrophic cardiomyopathy. Circ Cardiovasc Genet. 2014 Aug;7(4):434-43. Kapplinger JD et al. Distinguishing hypertrophic cardiomyopathy-associated mutations from background genetic noise. J Cardiovasc Transl Res. 2014 Apr;7(3):347-61. Maron BJ et al. Development of left ventricular hypertrophy in adults in hypertrophic cardiomyopathy caused by cardiac myosin-binding protein C gene mutations. J Am Coll Cardiol. 2001 Aug;38(2):315-21. Watkins H et al. Mutations in the cardiac myosin binding protein-C gene on chromosome 11 cause familial hypertrophic cardiomyopathy. Nat Genet. 1995 Dec;11(4):434-7. Zimmerman RS et al. A novel custom resequencing array for dilated cardiomyopathy. Genet Med. 2010 May;12(5):268-78. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Mar 29, 2022)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
GeneDx
Accession: SCV000208341.7
First in ClinVar: Feb 24, 2015 Last updated: Mar 04, 2023 |
Comment:
show
Identified in multiple individuals with HCM in published literature, also reported as Ins18bp1163 due to alternate nomenclature (Watkins et al., 1995; Maron et al., 2001; Kapplinger et al., 2014; Walsh et al., 2017), and identified in multiple individuals referred for HCM genetic testing at GeneDx.; Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of six amino acid residues (Gly, Gly, Ile, Tyr, Val, Cys), which is predicted to disrupt protein structure and stability (Watkins et al., 1995; Brown et al., 2002; Helms et al., 2014); Published functional study demonstrates the absence of mutant protein in septal myectomy and transplant tissue, suggesting this duplication may destabilize the protein and lead to haploinsufficiency (Helms et al., 2014; Helms et al., 2020); In-frame duplication of six amino acid residues (Gly, Gly, Ile, Tyr, Val, Cys), which is predicted to disrupt protein structure and stability (Watkins et al., 1995; Brown et al., 2002; Helms et al., 2014); This variant is associated with the following publications: (PMID: 12202917, 25714468, 24510615, 27532257, 29875314, 25031304, 7493025, 32841044, 15519027, 11499718) (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
|
|
|
Pathogenic
(Dec 18, 2023)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Hypertrophic cardiomyopathy
(Autosomal dominant inheritance)
|
All of Us Research Program, National Institutes of Health
Accession: SCV004836561.1
First in ClinVar: Apr 20, 2024 Last updated: Apr 20, 2024
Comment:
This study involves interpretation of variants in research participants for the purpose of population health screening. Participant phenotype was not available at the time of … (more)
This study involves interpretation of variants in research participants for the purpose of population health screening. Participant phenotype was not available at the time of variant classification. Additional details can be found in publication PMID: 35346344, PMCID: PMC8962531 (less)
|
Comment:
show
The c.3742_3759dup (p.Gly1248_Cys1253dup) variant duplicates 18 nucleotides in exon 33 of the MYBPC3 gene, leading to an in-frame duplication of 6 amino acid residues in the C-terminal Ig-like domain of the MYBPC3 protein. This variant has been reported in almost twenty individuals affected with hypertrophic cardiomyopathy (HCM) (PMID: 7493025, 11499718, 20474083, 23549607, 24510615, 27532257), as well as in an individual affected with dilated cardiomyopathy (DCM) (PMID: 20474083). It has also been observed to segregate with disease in 7 related individuals from a family affected with HCM (PMID: 7493025). In vitro experimental studies suggest that this in-frame variant affects the expression and structural stability of the MYBPC3 protein (PMID: 25031304, 12202917, 29875314). This variant has not been identified in the general population according to the Genome Aggregation Database (gnomAD). Based on these evidence, the c.3742_3759dup (p.Gly1248_Cys1253dup) variant in MYBPC3 gene is interpreted as pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Number of individuals with the variant: 3
Zygosity: 3 Single Heterozygotes
|
|
|
Pathogenic
(Jun 12, 2024)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Hypertrophic cardiomyopathy 4
Left ventricular noncompaction 10
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. |
Fulgent Genetics, Fulgent Genetics
Accession: SCV002804138.2
First in ClinVar: Dec 31, 2022 Last updated: Jan 25, 2025 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Jul 07, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Cardiomyopathy |
Color Diagnostics, LLC DBA Color Health
Accession: SCV001346706.5
First in ClinVar: Jun 22, 2020 Last updated: Feb 15, 2026 |
Comment:
show
This variant (also known as ins18bp1163) duplicates 18 nucleotides in exon 33 of the MYBPC3 gene, which leads to the duplication of 6 amino acid residues in the in the C-terminal Ig-like domain of the MYBPC3 protein. A functional study has shown that the variant affects protein stability (PMID: 25031304). This variant has been reported in over twenty individuals affected with or suspected to be affected with hypertrophic cardiomyopathy (PMID: 7493025, 11499718, 23549607, 24510615, 27532257, 33495597https://doi.org/10.1161/circ.142.suppl_3.15632communication with an external laboratory, ClinVar SCV000203962.4). This variant has been shown to segregate with disease in multiple affected individuals across multiple families (PMID: 7493025communication with an external laboratory, ClinVar SCV000203962.4). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Based on the available evidence, this variant is classified as Pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Platform type: NGS
|
|
|
Likely pathogenic
(Oct 15, 2014)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
Stanford Center for Inherited Cardiovascular Disease, Stanford University
Accession: SCV000280267.2
First in ClinVar: Jun 03, 2016 Last updated: Aug 04, 2026 |
Observation: 1
Collection method: provider interpretation
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: provider interpretation
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Dec 01, 1995)
N
Not contributing to aggregate classification
|
no assertion criteria provided
|
CARDIOMYOPATHY, FAMILIAL HYPERTROPHIC, 4 |
OMIM
Accession: SCV000029351.3
First in ClinVar: Apr 04, 2013 Last updated: Feb 15, 2020 |
Observation: 1
Collection method: literature only
Allele origin: germline
Affected status: not provided
Observation 1
Collection method: literature only
Allele origin: germline
Affected status: not provided
Comment on evidence:
In a family with chromosome 11-linked familial hypertrophic cardiomyopathy (CMH4; 115197), Watkins et al. (1995) demonstrated a heterozygous 18-bp tandem duplication of nucleotide residues 3774-3791. … (more)
In a family with chromosome 11-linked familial hypertrophic cardiomyopathy (CMH4; 115197), Watkins et al. (1995) demonstrated a heterozygous 18-bp tandem duplication of nucleotide residues 3774-3791. Sequencing of the genomic product confirmed the duplication, which occurred in the penultimate exon of the coding sequence (denoted exon P). The duplication was demonstrated in all affected members of the family and also in a presumed nonpenetrant 16-year-old member. It was not present in the other unaffected family members or in 200 chromosomes from unrelated, unaffected individuals. (less)
|
|
|
not provided
(-)
N
Not contributing to aggregate classification
|
no classification provided
|
Hypertrophic cardiomyopathy 4
Primary dilated cardiomyopathy Left ventricular noncompaction 1
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. |
GenomeConnect, ClinGen
Accession: SCV002818397.3
First in ClinVar: Jan 07, 2023 Last updated: Apr 13, 2025 |
Comment:
show
Variant classified as Pathogenic and reported on 11-03-2021 by Lab or GTR ID 500031. GenomeConnect assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. GenomeConnect staff make no attempt to reinterpret the clinical significance of the variant. (less)
Observation: 1
Collection method: phenotyping only
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: phenotyping only
Allele origin: unknown
Affected status: unknown
Clinical Features:
Abnormality of eye movement (present) , Myopia (present) , Tinnitus (present) , Cardiac arrhythmia (present) , Abnormal EKG (present) , Cardiomyopathy (present) , Abnormal esophagus morphology (present)
Indication for testing: Diagnostic
Age: 40-49 years
Sex: female
Method: Gene Panel Sequencing
Testing laboratory: Labcorp Genetics (formerly Invitae), Labcorp
Date variant was reported to submitter: 2021-11-03
Testing laboratory interpretation: Pathogenic
|
|
|
not provided
(-)
N
Not contributing to aggregate classification
|
no classification provided
|
Hypertrophic cardiomyopathy 4
Primary dilated cardiomyopathy Left ventricular noncompaction 1
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. |
GenomeConnect - Invitae Patient Insights Network
Accession: SCV006556367.1
First in ClinVar: Oct 18, 2025 Last updated: Oct 18, 2025 |
Comment:
show
Variant classified as Pathogenic and reported on 11-03-2021 by Invitae. GenomeConnect-InvitaePIN assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. (less)
Observation: 1
Collection method: phenotyping only
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: phenotyping only
Allele origin: unknown
Affected status: unknown
Clinical Features:
Myopia (present) , Tinnitus (present) , Bleeding with minor or no trauma (present) , Bruising susceptibility (present) , Epistaxis (present) , Abnormal erythrocyte morphology (present)
Indication for testing: Diagnostic
Zygosity: 1 Single Heterozygote
Age: 40-49 years
Sex: female
Method: Gene Panel Sequencing
Testing laboratory: Labcorp Genetics (formerly Invitae), Labcorp
Date variant was reported to submitter: 2021-11-03
Testing laboratory interpretation: Pathogenic
|
|
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Common genetic variants and modifiable risk factors underpin hypertrophic cardiomyopathy susceptibility and expressivity. | Harper AR | Nature genetics | 2021 | PMID: 33495597 |
| HSC70 is a chaperone for wild-type and mutant cardiac myosin binding protein C. | Glazier AA | JCI insight | 2018 | PMID: 29875314 |
| Reassessment of Mendelian gene pathogenicity using 7,855 cardiomyopathy cases and 60,706 reference samples. | Walsh R | Genetics in medicine : official journal of the American College of Medical Genetics | 2017 | PMID: 27532257 |
| A systematic approach to the reporting of medically relevant findings from whole genome sequencing. | McLaughlin HM | BMC medical genetics | 2014 | PMID: 25714468 |
| Sarcomere mutation-specific expression patterns in human hypertrophic cardiomyopathy. | Helms AS | Circulation. Cardiovascular genetics | 2014 | PMID: 25031304 |
| Distinguishing hypertrophic cardiomyopathy-associated mutations from background genetic noise. | Kapplinger JD | Journal of cardiovascular translational research | 2014 | PMID: 24510615 |
| T1 measurements identify extracellular volume expansion in hypertrophic cardiomyopathy sarcomere mutation carriers with and without left ventricular hypertrophy. | Ho CY | Circulation. Cardiovascular imaging | 2013 | PMID: 23549607 |
| Evaluation of second-generation sequencing of 19 dilated cardiomyopathy genes for clinical applications. | Gowrisankar S | The Journal of molecular diagnostics : JMD | 2010 | PMID: 20864638 |
| A novel custom resequencing array for dilated cardiomyopathy. | Zimmerman RS | Genetics in medicine : official journal of the American College of Medical Genetics | 2010 | PMID: 20474083 |
| Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy. | Van Driest SL | Journal of the American College of Cardiology | 2004 | PMID: 15519027 |
| Functional and spectroscopic studies of a familial hypertrophic cardiomyopathy mutation in Motif X of cardiac myosin binding protein-C. | Brown LJ | European biophysics journal : EBJ | 2002 | PMID: 12202917 |
| Development of left ventricular hypertrophy in adults in hypertrophic cardiomyopathy caused by cardiac myosin-binding protein C gene mutations. | Maron BJ | Journal of the American College of Cardiology | 2001 | PMID: 11499718 |
| Mutations in the cardiac myosin binding protein-C gene on chromosome 11 cause familial hypertrophic cardiomyopathy. | Watkins H | Nature genetics | 1995 | PMID: 7493025 |
| click to load more citations click to collapse | ||||
Text-mined citations for rs193922384 ...
HelpRecord last updated Aug 04, 2026
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.
