Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000019.4(ACAT1):c.64_72+10del

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 7, 2021)
Last evaluated:
May 7, 2019
Accession:
VCV000842676.2
Variation ID:
842676
Description:
19bp deletion
Help

NM_000019.4(ACAT1):c.64_72+10del

Allele ID
852292
Variant type
Deletion
Variant length
19 bp
Cytogenetic location
11q22.3
Genomic location
11: 108121668-108121686 (GRCh38) GRCh38 UCSC
11: 107992395-107992413 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000011.10:g.108121670_108121688del
NC_000011.9:g.107992397_107992415del
NM_000019.4:c.64_72+10del MANE Select splice donor
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000011.10:108121667:GGCTGGTGCAGGTGAGCGGGG:GG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter May 7, 2019 RCV001045131.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
ACAT1 - - GRCh38
GRCh37
345 365

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(May 07, 2019)
criteria provided, single submitter
Method: clinical testing
Deficiency of acetyl-CoA acetyltransferase
Allele origin: germline
Invitae
Accession: SCV001208965.2
Submitted: (Jan 07, 2021)
Evidence details
Publications
PubMed (1)
Comment:
This variant is a deletion of the genomic region encompassing part of exon 1 (c.64_72+10del) of the ACAT1 gene. It is expected to disrupt RNA … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Molecular basis of beta-ketothiolase deficiency: mutations and polymorphisms in the human mitochondrial acetoacetyl-coenzyme A thiolase gene. Fukao T Human mutation 1995 PMID: 7749408

Record last updated May 10, 2021