VCV000840834.16 - ClinVar

NM_000546.6(TP53):c.529_546del (p.Pro177_Cys182del)

Germline

Classification

criteria provided, conflicting classifications. Learn more about how ClinVar calculates review status.

Conflicting classifications of pathogenicity
Pathogenic (1); Likely pathogenic (2); Uncertain significance (1)

4 out of 4 submissions contributed to this classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

Somatic

Clinical impact

criteria provided, single submitter. Learn more about how ClinVar calculates review status.

Tier I (Strong) for Astrocytoma IDH-mutant

This classification is based on the single submission received

The aggregate somatic clinical impact for this variant for one or more tumor types, using the AMP/ASCO/CAP terminology. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

Somatic

Oncogenicity

criteria provided, single submitter. Learn more about how ClinVar calculates review status.

Likely oncogenic

This classification is based on the single submission received

The aggregate oncogenicity classification for this variant for one or more tumor types, using the ClinGen/CGC/VICC terminology. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

Variant Details

Identifiers

NM_000546.6(TP53):c.529_546del (p.Pro177_Cys182del)

Variation ID: 840834 Accession: VCV000840834.16

Type and length

Deletion, 18 bp

Location

Cytogenetic: 17p13.1 17: 7675066-7675083 (GRCh38) [ NCBI UCSC ] 17: 7578384-7578401 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 15, 2020	Feb 15, 2026	Mar 11, 2025
Somatic - Clinical impact	Nov 22, 2025	Nov 22, 2025	Apr 11, 2024
Somatic - Oncogenicity	Aug 11, 2024	Mar 11, 2025	Mar 4, 2025

HGVS

Nucleotide	Protein	Molecular consequence
NM_000546.6:c.529_546del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_000537.3:p.Pro177_Cys182del	inframe deletion
NM_000546.4:c.529_546delCCCCACCATGAGCGCTGC
NM_001126112.3:c.529_546del	NP_001119584.1:p.Pro177_Cys182del	inframe deletion
NM_001126113.3:c.529_546del	NP_001119585.1:p.Pro177_Cys182del	inframe deletion
NM_001126114.3:c.529_546del	NP_001119586.1:p.Pro177_Cys182del	inframe deletion
NM_001126115.2:c.133_150del	NP_001119587.1:p.Pro45_Cys50del	inframe deletion
NM_001126116.2:c.133_150del	NP_001119588.1:p.Pro45_Cys50del	inframe deletion
NM_001126117.2:c.133_150del	NP_001119589.1:p.Pro45_Cys50del	inframe deletion
NM_001126118.2:c.412_429del	NP_001119590.1:p.Pro138_Cys143del	inframe deletion
NM_001276695.3:c.412_429del	NP_001263624.1:p.Pro138_Cys143del	inframe deletion
NM_001276696.3:c.412_429del	NP_001263625.1:p.Pro138_Cys143del	inframe deletion
NM_001276697.3:c.52_69del	NP_001263626.1:p.Pro18_Cys23del	inframe deletion
NM_001276698.3:c.52_69del	NP_001263627.1:p.Pro18_Cys23del	inframe deletion
NM_001276699.3:c.52_69del	NP_001263628.1:p.Pro18_Cys23del	inframe deletion
NM_001276760.3:c.412_429del	NP_001263689.1:p.Pro138_Cys143del	inframe deletion
NM_001276761.3:c.412_429del	NP_001263690.1:p.Pro138_Cys143del	inframe deletion
NC_000017.11:g.7675073_7675090del
NC_000017.10:g.7578391_7578408del
NG_017013.2:g.17468_17485del
LRG_321:g.17468_17485del
LRG_321t1:c.529_546del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000017.11:7675065:GCAGCGCTCATGGTGGGGGCAGCGC:GCAGCGC

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA645588895 dbSNP: rs2073361326 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
TP53		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	3915	4016

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Li-Fraumeni syndrome	Pathogenic (1)	criteria provided, single submitter	Nov 19, 2024	RCV001042929.10
Hereditary cancer-predisposing syndrome	Likely pathogenic (1)	criteria provided, single submitter	Dec 9, 2024	RCV003160297.3
Li-Fraumeni syndrome 1	Likely pathogenic (1)	criteria provided, single submitter	Feb 14, 2024	RCV004031305.1
Hereditary breast ovarian cancer syndrome	Uncertain significance (1)	criteria provided, single submitter	Mar 11, 2025	RCV005251243.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	Expand all rows Collapse all rows Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Dec 09, 2024) C Contributing to aggregate classification	criteria provided, single submitter (Ambry Variant Classification Scheme 2023)	Hereditary cancer-predisposing syndrome	Ambry Genetics Accession: SCV003856778.3 First in ClinVar: Apr 15, 2023 Last updated: Jan 13, 2025	Publications: PubMed (2) PubMed: 33138793‚ 33245408 Comment: show The c.529_546del18 variant (also known as p.P177_C182del) is located in coding exon 4 of the TP53 gene. This variant results from an in-frame deletion of 18 nucleotides (CCCCACCATGAGCGCTGC) at nucleotide positions 529 to 546. This results in the in-frame deletion of 6 amino acids (PHHERC) at codons 177 to 182. Other variants impacting this region, p.P177R, p.H179Q, p.H179Y, p.E180K have been identified in individuals with features consistent with Li-Fraumeni syndrome (Ambry internal data). This alteration was detected in a cohort of 2538 Chinese breast cancer patients who tested negative for BRCA1/2 mutations (Kwong A et al. BMC Cancer, 2020 Nov;20:1053), as well as in a cohort of 1876 well-defined familial HBOC index patients from Germany who were tested negative for a germline BRCA1/2 mutations (Grill S et al. Arch Gynecol Obstet, 2021 Jun;303:1557-1567). These amino acid positions are generally well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the majority of available evidence to date, this variant is likely to be pathogenic. (less) Observation: 1 Collection method: clinical testing Allele origin: germline Affected status: unknown Observation 1 Collection method: clinical testing Allele origin: germline Affected status: unknown

Pathogenic (Nov 19, 2024) C Contributing to aggregate classification	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Li-Fraumeni syndrome	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV001206638.7 First in ClinVar: Apr 15, 2020 Last updated: Feb 15, 2026	Publications: PubMed (9) PubMed: 12826609‚ 20421238‚ 26787237‚ 27501770‚ 27873457‚ 29489754‚ 30224644‚ 33138793‚ 33245408 Comment: show This variant, c.529_546del, results in the deletion of 6 amino acid(s) of the TP53 protein (p.Pro177_Cys182del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of TP53-related conditions (PMID: 29489754, 33138793, 33245408). ClinVar contains an entry for this variant (Variation ID: 840834). This variant disrupts a region of the TP53 protein in which other variant(s) (p.Pro177Arg) have been determined to be pathogenic (PMID: 12826609, 20421238, 26787237, 27501770, 27873457, 30224644; internal data). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less) Observation: 1 Collection method: clinical testing Allele origin: germline Affected status: unknown Observation 1 Collection method: clinical testing Allele origin: germline Affected status: unknown

Likely pathogenic (Feb 14, 2024) C Contributing to aggregate classification	criteria provided, single submitter (Myriad Autosomal Dominant, Autosomal Recessive and X-Linked Classification Criteria (2023))	Li-Fraumeni syndrome 1	Myriad Genetics, Inc. Accession: SCV004933252.1 First in ClinVar: May 01, 2024 Last updated: May 01, 2024	Publications: PubMed (5) PubMed: 12509279‚ 16633321‚ 17530187‚ 21590121‚ 8336941 Comment: show This variant is considered likely pathogenic. This variant is expected to disrupt protein structure [Myriad internal data]. Functional studies indicate this variant impacts protein function [PMID: 8336941, 12509279, 17530187]. This variant has been reported in multiple individuals with clinical features of gene-specific disease [PMID: 16633321, 21590121]. (less) Observation: 1 Collection method: clinical testing Allele origin: unknown Affected status: unknown Observation 1 Collection method: clinical testing Allele origin: unknown Affected status: unknown

Uncertain significance (Mar 11, 2025) C Contributing to aggregate classification	criteria provided, single submitter (ClinGen TP53 V1.4.0)	Hereditary breast ovarian cancer syndrome	German Consortium for Hereditary Breast and Ovarian Cancer, University Hospital Cologne Accession: SCV005903104.1 First in ClinVar: Apr 07, 2025 Last updated: Apr 07, 2025	Comment: show According to the ClinGen ACMG TP53 v1.4.0 criteria we chose these criteria: PS2 (medium pathogenic): Kwong (2020, PMID: 33138793): Confirmed Germline de novo with VAF = 33.1%; Breast cancer with Age of Dx of 30 --> 2P, PS4 (supporting pathogenic): 2 x LFS1 Fälle (Lefrou L et al 2006, Ayan I et al 1997), 1 de novo; weitere Daten fehlen, PM1 (medium pathogenic): 10x in cancer hotspots, PM2 (supporting pathogenic): absent from gnomAD v4/3/2, PP3 (supporting pathogenic): BayesDel: 0,6431 (less) Observation: 1 Collection method: curation Allele origin: germline Affected status: not provided Observation 1 Collection method: curation Allele origin: germline Affected status: not provided

Comment:

The c.529_546del18 variant (also known as p.P177_C182del) is located in coding exon 4 of the TP53 gene. This variant results from an in-frame deletion of 18 nucleotides (CCCCACCATGAGCGCTGC) at nucleotide positions 529 to 546. This results in the in-frame deletion of 6 amino acids (PHHERC) at codons 177 to 182. Other variants impacting this region, p.P177R, p.H179Q, p.H179Y, p.E180K have been identified in individuals with features consistent with Li-Fraumeni syndrome (Ambry internal data). This alteration was detected in a cohort of 2538 Chinese breast cancer patients who tested negative for BRCA1/2 mutations (Kwong A et al. BMC Cancer, 2020 Nov;20:1053), as well as in a cohort of 1876 well-defined familial HBOC index patients from Germany who were tested negative for a germline BRCA1/2 mutations (Grill S et al. Arch Gynecol Obstet, 2021 Jun;303:1557-1567). These amino acid positions are generally well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the majority of available evidence to date, this variant is likely to be pathogenic.

Comment:

This variant, c.529_546del, results in the deletion of 6 amino acid(s) of the TP53 protein (p.Pro177_Cys182del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of TP53-related conditions (PMID: 29489754, 33138793, 33245408). ClinVar contains an entry for this variant (Variation ID: 840834). This variant disrupts a region of the TP53 protein in which other variant(s) (p.Pro177Arg) have been determined to be pathogenic (PMID: 12826609, 20421238, 26787237, 27501770, 27873457, 30224644; internal data). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.

Comment:

This variant is considered likely pathogenic. This variant is expected to disrupt protein structure [Myriad internal data]. Functional studies indicate this variant impacts protein function [PMID: 8336941, 12509279, 17530187]. This variant has been reported in multiple individuals with clinical features of gene-specific disease [PMID: 16633321, 21590121].

Comment:

According to the ClinGen ACMG TP53 v1.4.0 criteria we chose these criteria: PS2 (medium pathogenic): Kwong (2020, PMID: 33138793): Confirmed Germline de novo with VAF = 33.1%; Breast cancer with Age of Dx of 30 --> 2P, PS4 (supporting pathogenic): 2 x LFS1 Fälle (Lefrou L et al 2006, Ayan I et al 1997), 1 de novo; weitere Daten fehlen, PM1 (medium pathogenic): 10x in cancer hotspots, PM2 (supporting pathogenic): absent from gnomAD v4/3/2, PP3 (supporting pathogenic): BayesDel: 0,6431

Comment:

Variant has Tier I (strong) clinical significance as a diagnostic inclusion criterion in Astrocytoma IDH-mutant, based on the following evidence: 1) Documented in one or more cancer databases (e.g., St. Jude Pecan, COSMIC, CIViC, OncoKB). 2) Appears in one or more well-established professional guidelines (e.g., World Health Organization [WHO]; National Comprehensive Cancer Network [NCCN]) as providing diagnostic, prognostic, or therapeutic information. 3) Information in the literature supports potential biologic effect of variant (PMIDs: 11900253, 8023157). 4) Diagnostic for a specific tumor type/classification according to professional guidelines (Evidence Level A; PMIDs: 33772213, 24140581, 21971842, 33692446, 30326163).

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
TP53 germline mutations in the context of families with hereditary breast and ovarian cancer: a clinical challenge.	Grill S	Archives of gynecology and obstetrics	2021	PMID: 33245408
Mutation screening of germline TP53 mutations in high-risk Chinese breast cancer patients.	Kwong A	BMC cancer	2020	PMID: 33138793
Mutational processes shape the landscape of TP53 mutations in human cancer.	Giacomelli AO	Nature genetics	2018	PMID: 30224644
The landscape of genomic alterations across childhood cancers.	Gröbner SN	Nature	2018	PMID: 29489754
Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course-based undergraduate research experience in molecular and cell biology.	Hekmat-Scafe DS	Biochemistry and molecular biology education : a bimonthly publication of the International Union of Biochemistry and Molecular Biology	2017	PMID: 27873457
Biochemical and imaging surveillance in germline TP53 mutation carriers with Li-Fraumeni syndrome: 11 year follow-up of a prospective observational study.	Villani A	The Lancet. Oncology	2016	PMID: 27501770
Incidental germline variants in 1000 advanced cancers on a prospective somatic genomic profiling protocol.	Meric-Bernstam F	Annals of oncology : official journal of the European Society for Medical Oncology	2016	PMID: 26787237
Novel germ line mutation p53-P177R in adult adrenocortical carcinoma producing neuron-specific enolase as a possible marker.	Ide H	Japanese journal of clinical oncology	2010	PMID: 20421238
The over-expression of p53 H179Y residue mutation causes the increase of cyclin A1 and Cdk4 expression in HELF cells.	Yang D	Molecular and cellular biochemistry	2007	PMID: 17530187
[Germline tp53 neomutation in a patient with Li-Fraumeni syndrome and pancreatic adenocarcinoma].	Lefrou L	Gastroenterologie clinique et biologique	2006	PMID: 16633321
Understanding the function-structure and function-mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis.	Kato S	Proceedings of the National Academy of Sciences of the United States of America	2003	PMID: 12826609
A novel p53 mutant retained functional activity in lung carcinomas.	Ko JL	DNA repair	2002	PMID: 12509279
De novo germline mutations of the p53 gene in young children with sarcomas.	Ayan I	Oncology reports	1997	PMID: 21590121
Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences.	Chen JY	Oncogene	1993	PMID: 8336941
click to load more citations click to collapse

Conditions - Somatic

Tumor type Help The tumor type for this variant-condition (RCV) record in ClinVar.	Clinical impact (# of submissions) Help The aggregate somatic clinical impact for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to the aggregate somatic clinical impact is shown in parentheses. The corresponding review status for the RCV record is indicated by stars. Read our rules for calculating the review status.	Oncogenicity Help The aggregate oncogenicity classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to the aggregate oncogenicity classification is shown in parentheses. The corresponding review status for the RCV record is indicated by stars. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the tumor type.	Variation/condition record Help The most recent date that a submitter evaluated this variant for the tumor type.
Neoplasm		Likely oncogenic criteria provided, single submitter	Mar 4, 2025	RCV004671187.2
Astrocytoma IDH-mutant	Tier I (Strong) - diagnostic - supports diagnosis (1)		Apr 11, 2024	RCV006254190.1

Submissions - Somatic

Clinical impact Help The submitted somatic clinical impact for each SCV record. (Last evaluated)	Review Status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Tumor type Help The tumor type for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	Expand all rows Help This column includes more information supporting the somatic clinical impact, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.

Tier I (Strong) - Diagnostic - supports diagnosis (Apr 11, 2024) C Contributing to aggregate classification	criteria provided, single submitter (AMP/ASCO/CAP Guidelines, 2017)	Astrocytoma IDH-mutant	Institute for Genomic Medicine (IGM) Clinical Laboratory, Nationwide Children's Hospital Accession: SCV007105161.1 First In ClinVar: Nov 22, 2025 Last updated: Nov 22, 2025	Publications: PubMed (7) PubMed: 11900253‚ 21971842‚ 24140581‚ 30326163‚ 33692446‚ 33772213‚ 8023157 Comment: show Variant has Tier I (strong) clinical significance as a diagnostic inclusion criterion in Astrocytoma IDH-mutant, based on the following evidence: 1) Documented in one or more cancer databases (e.g., St. Jude Pecan, COSMIC, CIViC, OncoKB). 2) Appears in one or more well-established professional guidelines (e.g., World Health Organization [WHO]; National Comprehensive Cancer Network [NCCN]) as providing diagnostic, prognostic, or therapeutic information. 3) Information in the literature supports potential biologic effect of variant (PMIDs: 11900253, 8023157). 4) Diagnostic for a specific tumor type/classification according to professional guidelines (Evidence Level A; PMIDs: 33772213, 24140581, 21971842, 33692446, 30326163). (less) Observation: 1 Collection method: clinical testing Allele origin: somatic Affected status: yes Observation 1 Collection method: clinical testing Allele origin: somatic Affected status: yes

Oncogenicity Help The submitted oncogenicity classification for each SCV record. (Last evaluated)	Review Status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Tumor type Help The tumor type for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	Expand all rows Help This column includes more information supporting the somatic clinical impact, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.

Likely oncogenic (Mar 04, 2025) C Contributing to aggregate classification	criteria provided, single submitter (ClinGen/CGC/VICC Guidelines for Oncogenicity, 2022)	Neoplasm	Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital Accession: SCV005094437.2 First In ClinVar: Aug 11, 2024 Last updated: Mar 11, 2025	Observation: 1 Collection method: clinical testing Allele origin: somatic Affected status: yes Observation 1 Collection method: clinical testing Allele origin: somatic Affected status: yes

Comment:

Citations for somatic classification of this variant

Title	Author	Journal	Year	Link
IDH-mutant gliomas with additional class-defining molecular events.	Ahrendsen JT	Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc	2021	PMID: 33772213
Molecular landscape of IDH-mutant primary astrocytoma Grade IV/glioblastomas.	Wong QH	Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc	2021	PMID: 33692446
Integrated molecular characterization of IDH-mutant glioblastomas.	Korshunov A	Neuropathology and applied neurobiology	2019	PMID: 30326163
The genetic landscape of anaplastic astrocytoma.	Killela PJ	Oncotarget	2014	PMID: 24140581
IDH1/2 gene status defines the prognosis and molecular profiles in patients with grade III gliomas.	Shibahara I	International journal of clinical oncology	2012	PMID: 21971842
Rescuing the function of mutant p53.	Bullock AN	Nature reviews. Cancer	2001	PMID: 11900253
Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations.	Cho Y	Science (New York, N.Y.)	1994	PMID: 8023157

Text-mined citations for rs2073361326 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Apr 13, 2026