Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_004715.5(CTDP1):c.2418-207_2418-165dup

Help
Interpretation:
Benign​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Oct 22, 2019)
Last evaluated:
May 28, 2019
Accession:
VCV000803507.1
Variation ID:
803507
Description:
43bp duplication
Help

NM_004715.5(CTDP1):c.2418-207_2418-165dup

Allele ID
791884
Variant type
Duplication
Variant length
43 bp
Cytogenetic location
18q23
Genomic location
18: 79728698-79728699 (GRCh38) GRCh38 UCSC
18: 77488698-77488699 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_236:g.53900_53942dup
NC_000018.10:g.79728700_79728742dup
NC_000018.9:g.77488700_77488742dup
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000018.10:79728698:TGTTTTGCCAGTCACCCTGGCTCAGTTAGCAAATTCTGATCCAT:TGTTTTGCCAGTCACCCTGGCTCAGTTAGCAAATTCTGATCCATGTTTTGCCAGTCACCCTGGCTCAGTTAGCAAATTCTGATCCAT
Functional consequence
-
Global minor allele frequency (GMAF)
0.29173 (TGTTTTGCCAGTCACCCTGGCTCAGTTAGCAAATTCTGATCCATGTTTTGCCAGTCACCCTGGCTCAGTTAGCAAATTCTGATCCAT)

Allele frequency
-
Links
dbSNP: rs147933855
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Benign 1 criteria provided, single submitter May 28, 2019 RCV000990115.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
CTDP1 - - GRCh38
GRCh38
GRCh37
155 323

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Benign
(May 28, 2019)
criteria provided, single submitter
Method: clinical testing
Congenital cataracts-facial dysmorphism-neuropathy syndrome
Allele origin: unknown
Mendelics
Accession: SCV001140920.1
Submitted: (Oct 22, 2019)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs147933855...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 20, 2021