Variant classified as Uncertain Significance - Favor Benign. The c.5766-13_5766-2dup variant in MYH9 has not been previously reported in individuals with hearing loss or macrothrombocytopenia. Data from large population studies is insufficient to assess the frequency of this variant. This variant is a duplication of 11 nucleotides in the 3' splice region and encompasses the splice consensus sequence. Computational tools do not predict an impact to splicing, though this information is not predictive enough to rule out pathogenicity. In summary, while the clinical significance of this variant is uncertain, the computational data suggest that it is more likely to be benign. ACMG/AMP Criteria applied: BP4.
ClinVar Genomic variation as it relates to human health
Help
- Interpretation:
-
Uncertain significance
- Review status:
- criteria provided, single submitter
- Submissions:
- 1
- First in ClinVar:
- Aug 26, 2019
- Most recent Submission:
- Aug 26, 2019
- Last evaluated:
- Feb 13, 2019
- Accession:
- VCV000666868.5
- Variation ID:
- 666868
- Description:
- 12bp duplication
Help
NM_002473.6(MYH9):c.5766-13_5766-2dup
- Allele ID
- 654928
- Variant type
- Duplication
- Variant length
- 12 bp
- Cytogenetic location
- 22q12.3
- Genomic location
- 22: 36282786-36282787 (GRCh38) GRCh38 UCSC
- 22: 36678832-36678833 (GRCh37) GRCh37 UCSC
- HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_002473.6:c.5766-13_5766-2dup MANE Select splice acceptor NC_000022.11:g.36282788_36282799dup NC_000022.10:g.36678834_36678845dup NG_011884.2:g.110221_110232dup LRG_567:g.110221_110232dup - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000022.11:36282786:TGGGGGCAGAGGT:TGGGGGCAGAGGTGGGGGCAGAGGT
- Functional consequence
- -
- Global minor allele frequency (GMAF)
- -
- Allele frequency
- -
- Links
- dbSNP: rs1603482655
- VarSome
Help
Aggregate interpretations per condition
| Interpreted condition | Interpretation | Number of submissions | Review status | Last evaluated | Variation/condition record |
|---|---|---|---|---|---|
| Uncertain significance | 1 | criteria provided, single submitter | Feb 13, 2019 | RCV000825384.4 |
Submitted interpretations and evidence
Help| Interpretation (Last evaluated) |
Review status (Assertion criteria) |
Condition (Inheritance) |
Submitter | More information | |
|---|---|---|---|---|---|
|
Uncertain significance
(Feb 13, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV000966680.2
First in ClinVar: Aug 26, 2019 Last updated: Aug 26, 2019 |
Comment:
Variant classified as Uncertain Significance - Favor Benign. The c.5766-13_5766-2dup variant in MYH9 has not been previously reported in individuals with hearing loss or macrothrombocytopenia. … (more)
Variant classified as Uncertain Significance - Favor Benign. The c.5766-13_5766-2dup variant in MYH9 has not been previously reported in individuals with hearing loss or macrothrombocytopenia. Data from large population studies is insufficient to assess the frequency of this variant. This variant is a duplication of 11 nucleotides in the 3' splice region and encompasses the splice consensus sequence. Computational tools do not predict an impact to splicing, though this information is not predictive enough to rule out pathogenicity. In summary, while the clinical significance of this variant is uncertain, the computational data suggest that it is more likely to be benign. ACMG/AMP Criteria applied: BP4. (less)
Number of individuals with the variant: 1
|
Functional evidence
Help| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for this variant
Help| There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs1603482655...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Dec 24, 2022