Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000528.4(MAN2B1):c.2864_2879del (p.Thr955fs)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Apr 26, 2017)
Last evaluated:
Jan 1, 2015
Accession:
VCV000666350.1
Variation ID:
666350
Description:
16bp deletion
Help

NM_000528.4(MAN2B1):c.2864_2879del (p.Thr955fs)

Allele ID
653896
Variant type
Deletion
Variant length
16 bp
Cytogenetic location
19p13.13
Genomic location
19: 12647277-12647292 (GRCh38) GRCh38 UCSC
19: 12758091-12758106 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000019.10:g.12647281_12647296del
NC_000019.9:g.12758095_12758110del
NM_000528.4:c.2864_2879del MANE Select NP_000519.2:p.Thr955fs frameshift
... more HGVS
Protein change
T955fs, T954fs
Other names
-
Canonical SPDI
NC_000019.10:12647276:TGGTTGGCCACCAGCGTGGT:TGGT
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1599337939
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Jan 1, 2015 RCV000824891.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
MAN2B1 - - GRCh38
GRCh37
626 646

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Jan 01, 2015)
criteria provided, single submitter
Method: clinical testing
Deficiency of alpha-mannosidase
Allele origin: inherited
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne
Accession: SCV000965807.1
Submitted: (Apr 26, 2017)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1599337939...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jan 25, 2021