Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000020.3(ACVRL1):c.1027_1047del (p.Gln343_Leu349del)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Mar 28, 2019)
Last evaluated:
Sep 24, 2018
Accession:
VCV000658059.1
Variation ID:
658059
Description:
21bp deletion
Help

NM_000020.3(ACVRL1):c.1027_1047del (p.Gln343_Leu349del)

Allele ID
641246
Variant type
Deletion
Variant length
21 bp
Cytogenetic location
12q13.13
Genomic location
12: 51915474-51915494 (GRCh38) GRCh38 UCSC
12: 52309258-52309278 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NM_000020.2:c.1027_1047delCAGTGTTGCATCGCCGACCTG
LRG_543:g.13062_13082del
NC_000012.11:g.52309263_52309283del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000012.12:51915473:ACCTGCAGTGTTGCATCGCCGACCTG:ACCTG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1592224385
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter Sep 24, 2018 RCV000814801.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
ACVRL1 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
573 584

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Sep 24, 2018)
criteria provided, single submitter
Method: clinical testing
Hereditary hemorrhagic telangiectasia type 2
Allele origin: germline
Invitae
Accession: SCV000955228.1
Submitted: (Mar 28, 2019)
Evidence details
Publications
PubMed (7)
Comment:
This variant, c.1027_1047delCAGTGTTGCATCGCCGACCTG, results in the deletion of 7 amino acid(s) of the ACVRL1 protein (p.Gln343_Leu349del), but otherwise preserves the integrity of the reading frame. … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Clinical and analytical sensitivities in hereditary hemorrhagic telangiectasia testing and a report of de novo mutations. Gedge F The Journal of molecular diagnostics : JMD 2007 PMID: 17384219
Mutation analysis in hereditary haemorrhagic telangiectasia in Germany reveals 11 novel ENG and 12 novel ACVRL1/ALK1 mutations. Wehner LE Clinical genetics 2006 PMID: 16542389
Functional analysis of mutations in the kinase domain of the TGF-beta receptor ALK1 reveals different mechanisms for induction of hereditary hemorrhagic telangiectasia. Gu Y Blood 2006 PMID: 16282348
High frequency of ENG and ALK1/ACVRL1 mutations in German HHT patients. Schulte C Human mutation 2005 PMID: 15880681
Molecular and functional analysis identifies ALK-1 as the predominant cause of pulmonary hypertension related to hereditary haemorrhagic telangiectasia. Harrison RE Journal of medical genetics 2003 PMID: 14684682
Identification of 13 new mutations in the ACVRL1 gene in a group of 52 unselected Italian patients affected by hereditary haemorrhagic telangiectasia. Olivieri C Journal of medical genetics 2002 PMID: 12114496
Analysis of ALK-1 and endoglin in newborns from families with hereditary hemorrhagic telangiectasia type 2. Abdalla SA Human molecular genetics 2000 PMID: 10767348

Text-mined citations for rs1592224385...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 24, 2021