Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000166.6(GJB1):c.332_349del (p.His111_His116del)

Help
Interpretation:
Uncertain significance​

Review status:
no assertion criteria provided
Submissions:
1 (Most recent: Jul 10, 2019)
Accession:
VCV000637922.1
Variation ID:
637922
Description:
18bp deletion
Help

NM_000166.6(GJB1):c.332_349del (p.His111_His116del)

Allele ID
625580
Variant type
Deletion
Variant length
18 bp
Cytogenetic location
Xq13.1
Genomic location
X: 70443887-70443904 (GRCh37) GRCh37 UCSC
X: 71224037-71224054 (GRCh38) GRCh38 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NM_000166.6:c.332_349del18 MANE Select
NC_000023.10:g.70443889_70443906del
NC_000023.11:g.71224039_71224056del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000023.11:71224036:CCATGGGGACCCCCTACACC:CC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1602349197
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 no assertion criteria provided - RCV000790301.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
GJB1 - - GRCh38
GRCh37
599 731

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(-)
no assertion criteria provided
Method: literature only
Charcot-Marie-Tooth disease
Allele origin: germline
Inherited Neuropathy Consortium
Accession: SCV000929707.1
Submitted: (Jul 10, 2019)
Evidence details
Publications
PubMed (1)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy. Ionasescu V American journal of medical genetics 1996 PMID: 8737658

Text-mined citations for rs1602349197...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021