Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000551.4(VHL):c.419_427delinsACAATTATTTGTGCCATCTCTCAA (p.Leu140_Asp143delinsHisAsnTyrLeuCysHisLeuSerAsn)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 10, 2019)
Last evaluated:
Aug 1, 2018
Accession:
VCV000625246.1
Variation ID:
625246
Description:
24bp indel
Help

NM_000551.4(VHL):c.419_427delinsACAATTATTTGTGCCATCTCTCAA (p.Leu140_Asp143delinsHisAsnTyrLeuCysHisLeuSerAsn)

Allele ID
613578
Variant type
Indel
Variant length
24 bp
Cytogenetic location
3p25.3
Genomic location
3: 10146592-10146600 (GRCh38) GRCh38 UCSC
3: 10188276-10188284 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000003.11:g.10188276_10188284delinsACAATTATTTGTGCCATCTCTCAA
NC_000003.12:g.10146592_10146600delinsACAATTATTTGTGCCATCTCTCAA
NM_000551.4:c.419_427delinsACAATTATTTGTGCCATCTCTCAA MANE Select NP_000542.1:p.Leu140_Asp143delinsHisAsnTyrLeuCysHisLeuSerAsn
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000003.12:10146591:TCAATGTTG:ACAATTATTTGTGCCATCTCTCAA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1559428180
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Aug 1, 2018 RCV000767270.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
VHL Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
550 1356
LOC107303340 - - - GRCh38 - 775

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Aug 01, 2018)
criteria provided, single submitter
Method: clinical testing
von Hippel-Lindau syndrome
Allele origin: germline
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia
Accession: SCV000897822.1
Submitted: (Jan 10, 2019)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1559428180...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated May 10, 2021