Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_020631.6(PLEKHG5):c.1598_1612del (p.Gln533_Arg537del)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
2 (Most recent: Jul 4, 2021)
Last evaluated:
Dec 24, 2018
Accession:
VCV000623667.9
Variation ID:
623667
Description:
15bp deletion
Help

NM_020631.6(PLEKHG5):c.1598_1612del (p.Gln533_Arg537del)

Allele ID
612539
Variant type
Deletion
Variant length
15 bp
Cytogenetic location
1p36.31
Genomic location
1: 6470574-6470588 (GRCh38) GRCh38 UCSC
1: 6530634-6530648 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000001.10:g.6530645_6530659del
NC_000001.11:g.6470585_6470599del
NG_007978.1:g.54422_54436del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000001.11:6470573:GCCGCTGCCGCTCCTGCCGCTGCCGC:GCCGCTGCCGC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1557739505
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter May 1, 2018 RCV000761630.3
Uncertain significance 1 criteria provided, single submitter Dec 24, 2018 RCV000823148.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
PLEKHG5 - - GRCh38
GRCh37
671 739

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Dec 24, 2018)
criteria provided, single submitter
Method: clinical testing
Distal spinal muscular atrophy, autosomal recessive 4
Charcot-Marie-Tooth disease, recessive intermediate c
Allele origin: germline
Invitae
Accession: SCV000963996.1
Submitted: (Mar 28, 2019)
Evidence details
Comment:
This variant, c.1598_1612del, results in the deletion of 5 amino acid(s) of the PLEKHG5 protein (p.Gln533_Arg537del), but otherwise preserves the integrity of the reading frame. … (more)
Uncertain significance
(May 01, 2018)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
CeGaT Praxis fuer Humangenetik Tuebingen
Accession: SCV000891800.8
Submitted: (Jul 04, 2021)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1557739505...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021