Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000238.4(KCNH2):c.910_916+11del

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Aug 29, 2018)
Last evaluated:
Jun 28, 2018
Accession:
VCV000582292.1
Variation ID:
582292
Description:
18bp deletion
Help

NM_000238.4(KCNH2):c.910_916+11del

Allele ID
564166
Variant type
Deletion
Variant length
18 bp
Cytogenetic location
7q36.1
Genomic location
7: 150958048-150958065 (GRCh38) GRCh38 UCSC
7: 150655136-150655153 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_288:g.24862_24879del
LRG_288t2:c.910_916+11del
NM_000238.3:c.910_916+11delAGCACCGGTGAGGGCGCC splice donor
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000007.14:150958047:GGCGCCCTCACCGGTGCTGGCG:GGCG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1563169296
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Jun 28, 2018 RCV000706331.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
KCNH2 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
2027 2098

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Jun 28, 2018)
criteria provided, single submitter
Method: clinical testing
Long QT syndrome
Allele origin: germline
Invitae
Accession: SCV000835374.1
Submitted: (Aug 29, 2018)
Evidence details
Publications
PubMed (1)
Comment:
This variant is a gross deletion of the genomic region encompassing part of exon 4 (c.910_916+11del) of the KCNH2 gene. It is expected to disrupt … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria. Nykamp K Genetics in medicine : official journal of the American College of Medical Genetics 2017 PMID: 28492532

Text-mined citations for rs1563169296...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021