Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001943.5(DSG2):c.1752_1784del (p.Gln584_Leu594del)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
2 (Most recent: Aug 19, 2021)
Last evaluated:
Sep 13, 2019
Accession:
VCV000579139.4
Variation ID:
579139
Description:
33bp deletion
Help

NM_001943.5(DSG2):c.1752_1784del (p.Gln584_Leu594del)

Allele ID
574731
Variant type
Deletion
Variant length
33 bp
Cytogenetic location
18q12.1
Genomic location
18: 31538848-31538880 (GRCh38) GRCh38 UCSC
18: 29118811-29118843 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_397t1:c.1752_1784del
LRG_397:g.45610_45642del
NC_000018.10:g.31538851_31538883del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000018.10:31538847:GCAGGTCCTTACACTCACAGTTTGTGAGTGTCTGCA:GCA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1333431543
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter May 25, 2018 RCV000702348.1
Uncertain significance 1 criteria provided, single submitter Sep 13, 2019 RCV001571015.3
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
DSG2 Little evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
638 1094

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(May 25, 2018)
criteria provided, single submitter
Method: clinical testing
Arrhythmogenic right ventricular cardiomyopathy, type 10
Allele origin: germline
Invitae
Accession: SCV000831200.1
Submitted: (Aug 29, 2018)
Evidence details
Publications
PubMed (1)
Comment:
This variant, c.1752_1784delGGTCCTTACACTCACAGTTTGTGAGTGTCTGCA, results in the deletion of 11 amino acid(s) of the DSG2 protein (p.Gln584_Leu594del), but otherwise preserves the integrity of the reading frame. … (more)
Uncertain significance
(Sep 13, 2019)
criteria provided, single submitter
Method: clinical testing
Not Provided
Allele origin: germline
GeneDx
Accession: SCV001795406.1
Submitted: (Aug 19, 2021)
Evidence details
Comment:
Has not been previously published as pathogenic or benign to our knowledge; Not observed in large population cohorts (Lek et al., 2016); Reported in ClinVar … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria. Nykamp K Genetics in medicine : official journal of the American College of Medical Genetics 2017 PMID: 28492532

Text-mined citations for rs1333431543...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 29, 2021