VCV000559570.1 - ClinVar

NM_014963.3(SBNO2):c.3177_3189dup (p.Tyr1064fs)

Germline

Classification

criteria provided, single submitter. Learn more about how ClinVar calculates review status.

Uncertain significance

This classification is based on the single submission received

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_014963.3(SBNO2):c.3177_3189dup (p.Tyr1064fs)

Variation ID: 559570 Accession: VCV000559570.1

Type and length

Duplication, 13 bp

Location

Cytogenetic: 19p13.3 19: 1109532-1109533 (GRCh38) [ NCBI UCSC ] 19: 1109531-1109532 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 17, 2018	Aug 17, 2018	Jun 21, 2018

HGVS

Nucleotide	Protein	Molecular consequence
NM_014963.3:c.3177_3189dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_055778.2:p.Tyr1064fs	frameshift
NM_001100122.2:c.3006_3018dup	NP_001093592.1:p.Tyr1007fs	frameshift
NC_000019.10:g.1109534_1109546dup
NC_000019.9:g.1109533_1109545dup

Protein change

Y1007fs, Y1064fs

Other names

Canonical SPDI

NC_000019.10:1109532:GGGGCCCGTCAGCG:GGGGCCCGTCAGCGGGGCCCGTCAGCG

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs1555717920 ClinGen: CA658824084 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
SBNO2		-	-	GRCh38 GRCh38 GRCh37	347	393

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Uncertain significance (1)	criteria provided, single submitter	Jun 21, 2018	RCV000677294.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	Expand all rows Collapse all rows Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Uncertain significance (Jun 21, 2018) C Contributing to aggregate classification	criteria provided, single submitter (ACMG Guidelines, 2015)	not provided	Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics Accession: SCV000803427.1 First in ClinVar: Aug 17, 2018 Last updated: Aug 17, 2018	Observation: 1 Collection method: clinical testing Allele origin: germline Affected status: not provided more Observation 1 Collection method: clinical testing Allele origin: germline Affected status: not provided Platform type: Sequencing Platform name: Illumina

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1555717920 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Apr 25, 2022