Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000137.3(FAH):c.854_855insTGGCCCCTGCC (p.Tyr286fs)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jul 10, 2018)
Last evaluated:
Mar 1, 2018
Accession:
VCV000556983.1
Variation ID:
556983
Description:
11bp insertion
Help

NM_000137.3(FAH):c.854_855insTGGCCCCTGCC (p.Tyr286fs)

Allele ID
547606
Variant type
Insertion
Variant length
11 bp
Cytogenetic location
15q25.1
Genomic location
15: 80175022-80175023 (GRCh38) GRCh38 UCSC
15: 80467364-80467365 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000015.10:g.80175032_80175033insTGGCCCCTGCC
NM_000137.3:c.854_855insTGGCCCCTGCC NP_000128.1:p.Tyr286fs frameshift
NC_000015.9:g.80467374_80467375insTGGCCCCTGCC
NG_012833.1:g.27034_27035insTGGCCCCTGCC
Protein change
Y286fs
Other names
-
Canonical SPDI
NC_000015.10:80175022:GGCCCCTGCC:GGCCCCTGCCTGGCCCCTGCC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1555441852
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Mar 1, 2018 RCV000673058.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
FAH - - GRCh38
GRCh37
392 411

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Mar 01, 2018)
criteria provided, single submitter
Method: clinical testing
Tyrosinemia type I
Allele origin: unknown
Counsyl
Accession: SCV000798224.1
Submitted: (Jul 10, 2018)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1555441852...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021