Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000487.6(ARSA):c.109_126dup (p.Asp37_Gly42dup)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jul 10, 2018)
Last evaluated:
Jan 30, 2018
Accession:
VCV000556367.1
Variation ID:
556367
Description:
18bp duplication
Help

NM_000487.6(ARSA):c.109_126dup (p.Asp37_Gly42dup)

Allele ID
549454
Variant type
Duplication
Variant length
18 bp
Cytogenetic location
22q13.33
Genomic location
22: 50627653-50627654 (GRCh38) GRCh38 UCSC
22: 51066081-51066082 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000022.10:g.51066090_51066107dup
NC_000022.11:g.50627662_50627679dup
NG_009260.2:g.5509_5526dup
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000022.11:50627653:CCCATAGCAGCCCAGGTCCCCATAGC:CCCATAGCAGCCCAGGTCCCCATAGCAGCCCAGGTCCCCATAGC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1555901139
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter Jan 30, 2018 RCV000672365.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
ARSA - - GRCh38
GRCh37
593 729

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Jan 30, 2018)
criteria provided, single submitter
Method: clinical testing
Metachromatic leukodystrophy
Allele origin: unknown
Counsyl
Accession: SCV000797463.1
Submitted: (Jul 10, 2018)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1555901139...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 30, 2021