Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_133259.4(LRPPRC):c.62_79dup (p.Pro21_Leu26dup)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jul 10, 2018)
Last evaluated:
Mar 22, 2017
Accession:
VCV000550989.1
Variation ID:
550989
Description:
18bp duplication
Help

NM_133259.4(LRPPRC):c.62_79dup (p.Pro21_Leu26dup)

Allele ID
542132
Variant type
Duplication
Variant length
18 bp
Cytogenetic location
2p21
Genomic location
2: 43995868-43995869 (GRCh38) GRCh38 UCSC
2: 44223007-44223008 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000002.11:g.44223016_44223033dup
NC_000002.12:g.43995877_43995894dup
NG_008247.1:g.5120_5137dup
NM_133259.4:c.62_79dup MANE Select NP_573566.2:p.Pro21_Leu26dup
Protein change
-
Other names
-
Canonical SPDI
NC_000002.12:43995868:GGAGGCGCAGGGAGAGCGGGAGGCGC:GGAGGCGCAGGGAGAGCGGGAGGCGCAGGGAGAGCGGGAGGCGC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs760874906
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter Mar 22, 2017 RCV000665919.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
LRPPRC - - GRCh38
GRCh37
785 806

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Mar 22, 2017)
criteria provided, single submitter
Method: clinical testing
Congenital lactic acidosis, Saguenay-Lac-Saint-Jean type
Allele origin: unknown
Counsyl
Accession: SCV000790125.1
Submitted: (Jul 10, 2018)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs760874906...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021