Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000135.4(FANCA):c.2853-15_2856del

Help
Interpretation:
Pathogenic/Likely pathogenic​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
3 (Most recent: Jan 7, 2021)
Last evaluated:
Jul 3, 2020
Accession:
VCV000550055.4
Variation ID:
550055
Description:
19bp deletion
Help

NM_000135.4(FANCA):c.2853-15_2856del

Allele ID
547931
Variant type
Deletion
Variant length
19 bp
Cytogenetic location
16q24.3
Genomic location
16: 89758702-89758720 (GRCh38) GRCh38 UCSC
16: 89825110-89825128 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000016.10:g.89758706_89758724del
NC_000016.9:g.89825114_89825132del
NG_011706.1:g.62938_62956del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000016.10:89758701:CTGCCTAGAACAGCAAACACTGC:CTGC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1285346388
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 2 criteria provided, single submitter Oct 5, 2017 RCV000664679.2
Pathogenic 1 criteria provided, single submitter Jul 3, 2020 RCV001384022.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
FANCA - - GRCh38
GRCh37
2162 2653

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Oct 05, 2017)
criteria provided, single submitter
Method: clinical testing
Fanconi anemia, complementation group A
Allele origin: unknown
Counsyl
Accession: SCV000788680.1
Submitted: (Jul 10, 2018)
Evidence details
Publications
PubMed (2)
Pathogenic
(Jul 03, 2020)
criteria provided, single submitter
Method: clinical testing
Fanconi anemia
Allele origin: germline
Invitae
Accession: SCV001583384.1
Submitted: (Jan 07, 2021)
Evidence details
Publications
PubMed (6)
Comment:
This variant results in the deletion of part of exon 30 (c.2853-15_2856del) of the FANCA gene. It is expected to disrupt RNA splicing and likely … (more)
Pathogenic
(Feb 28, 2020)
no assertion criteria provided
Method: curation
Fanconi anemia, complementation group A
Allele origin: germline
Leiden Open Variation Database
Accession: SCV001425701.1
Submitted: (Mar 04, 2020)
Evidence details
Publications
PubMed (1)
Comment:
Curator: Arleen D. Auerbach. Submitters to LOVD: Arleen D. Auerbach, Daniela Pilonetto, Johan de Winter.

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients. Solanki A PloS one 2016 PMID: 26799702
Molecular analysis of Fanconi anemia: the experience of the Bone Marrow Failure Study Group of the Italian Association of Pediatric Onco-Hematology. De Rocco D Haematologica 2014 PMID: 24584348
Human Fanconi anemia complementation group a protein stimulates the 5' flap endonuclease activity of FEN1. Qian L PloS one 2013 PMID: 24349332
Validation of Fanconi anemia complementation Group A assignment using molecular analysis. Moghrabi NN Genetics in medicine : official journal of the American College of Medical Genetics 2009 PMID: 19367192
Genetic subtyping of Fanconi anemia by comprehensive mutation screening. Ameziane N Human mutation 2008 PMID: 17924555
Sequence variation in the Fanconi anemia gene FAA. Levran O Proceedings of the National Academy of Sciences of the United States of America 1997 PMID: 9371798

Text-mined citations for rs1285346388...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021