Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000492.4(CFTR):c.100_117del (p.Leu34_Gln39del)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
2 (Most recent: Nov 11, 2018)
Last evaluated:
Nov 5, 2018
Accession:
VCV000053164.1
Variation ID:
53164
Description:
18bp deletion
Help

NM_000492.4(CFTR):c.100_117del (p.Leu34_Gln39del)

Allele ID
67832
Variant type
Deletion
Variant length
18 bp
Cytogenetic location
7q31.2
Genomic location
7: 117504297-117504314 (GRCh38) GRCh38 UCSC
7: 117144351-117144368 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000007.13:g.117144353_117144370del
NC_000007.14:g.117504299_117504316del
NG_016465.4:g.43516_43533del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000007.14:117504296:AATTGTCAGACATATACCAA:AA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA326365
dbSNP: rs397508141
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 2 criteria provided, single submitter Nov 5, 2018 RCV000577512.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
CFTR - - GRCh38
GRCh37
1974 2730

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Nov 05, 2018)
criteria provided, single submitter
Method: clinical testing
Cystic fibrosis
Allele origin: unknown
Mendelics
Accession: SCV000886164.1
Submitted: (Nov 11, 2018)
Evidence details
not provided
(-)
no assertion provided
Method: literature only
CFTR-related disorders
Allele origin: germline
ClinVar Staff, National Center for Biotechnology Information (NCBI)
Accession: SCV000678874.1
Submitted: (Mar 30, 2013)
Evidence details
Publications
PubMed (1)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Cystic fibrosis in a southern Brazilian population: characteristics of 90% of the alleles. Faucz FR Clinical genetics 2007 PMID: 17718859

Text-mined citations for rs397508141...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021