Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001927.4(DES):c.1255_1271del (p.Pro419fs)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
2 (Most recent: Jul 4, 2021)
Last evaluated:
Jun 1, 2021
Accession:
VCV000522796.2
Variation ID:
522796
Description:
17bp deletion
Help

NM_001927.4(DES):c.1255_1271del (p.Pro419fs)

Allele ID
513411
Variant type
Deletion
Variant length
17 bp
Cytogenetic location
2q35
Genomic location
2: 219423784-219423800 (GRCh38) GRCh38 UCSC
2: 220288506-220288522 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_380t1:c.1255_1271del17
LRG_380t1:c.1255_1271del
LRG_380:g.10411_10427del
... more HGVS
Protein change
P419fs
Other names
-
Canonical SPDI
NC_000002.12:219423783:CTCCCCATCCAGACCTACTC:CTC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA658796176
dbSNP: rs1553603732
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Jan 31, 2017 RCV000625960.1
Pathogenic 1 criteria provided, single submitter Jun 1, 2021 RCV001531343.1

Clinical features observed in individuals with this variant

Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
DES - - GRCh38
GRCh37
569 607

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Jan 31, 2017)
criteria provided, single submitter
Method: clinical testing
Myofibrillar myopathy 1
(Autosomal recessive inheritance)
Allele origin: inherited
Undiagnosed Diseases Network,NIH
Study: Undiagnosed Diseases Network (NIH), UDN
Accession: SCV000746558.1
Submitted: (Mar 27, 2018)
Evidence details
Comment:
This frameshift mutation is categorized as deleterious according to ACMG guidelines (PMID: 18414213) and was found homozygous in an 18-year-old male with congenital hypotonia, motor … (more)
Pathogenic
(Jun 01, 2021)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
CeGaT Praxis fuer Humangenetik Tuebingen
Accession: SCV001746397.1
Submitted: (Jul 04, 2021)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1553603732...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021