Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000551.4(VHL):c.483_500dup (p.Cys162_Arg167dup)

Help
Interpretation:
Conflicting interpretations of pathogenicity​

Likely pathogenic(1);Uncertain significance(2)

Review status:
criteria provided, conflicting interpretations
Submissions:
3 (Most recent: Jan 7, 2021)
Last evaluated:
Oct 4, 2020
Accession:
VCV000480846.5
Variation ID:
480846
Description:
18bp duplication
Help

NM_000551.4(VHL):c.483_500dup (p.Cys162_Arg167dup)

Allele ID
473321
Variant type
Duplication
Variant length
18 bp
Cytogenetic location
3p25.3
Genomic location
3: 10149803-10149804 (GRCh38) GRCh38 UCSC
3: 10191487-10191488 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NM_000551.3:c.483_500dupATGCCTCCAGGTTGTCCG
NC_000003.11:g.10191490_10191507dup
NC_000003.12:g.10149806_10149823dup
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000003.12:10149803:CGATGCCTCCAGGTTGTCCG:CGATGCCTCCAGGTTGTCCGATGCCTCCAGGTTGTCCG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA658655759
dbSNP: rs1553620312
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Nov 2, 2017 RCV000564563.1
Uncertain significance 1 criteria provided, single submitter Aug 1, 2018 RCV000767278.1
Uncertain significance 1 criteria provided, single submitter Oct 4, 2020 RCV001373035.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
VHL Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
550 1356
LOC107303340 - - - GRCh38 - 775

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Aug 01, 2018)
criteria provided, single submitter
Method: clinical testing
von Hippel-Lindau syndrome
Allele origin: germline
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia
Accession: SCV000897832.1
Submitted: (Jan 10, 2019)
Evidence details
Likely pathogenic
(Nov 02, 2017)
criteria provided, single submitter
Method: clinical testing
Hereditary cancer-predisposing syndrome
Allele origin: germline
Ambry Genetics
Accession: SCV000664697.3
Submitted: (Nov 30, 2020)
Evidence details
Publications
PubMed (1)
Comment:
The c.483_500dup18 pathogenic mutation (also known as p.C162_R167dup), located in coding exon 3 of the VHL gene, results from an in-frame duplication of 18 nucleotides … (more)
Uncertain significance
(Oct 04, 2020)
criteria provided, single submitter
Method: clinical testing
Von Hippel-Lindau syndrome
Erythrocytosis, familial, 2
Allele origin: germline
Invitae
Accession: SCV001569733.1
Submitted: (Jan 07, 2021)
Evidence details
Comment:
This variant, c.483_500dup, results in the insertion of 6 amino acid(s) to the VHL protein (p.Cys162_Arg167dup), but otherwise preserves the integrity of the reading frame. … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Dissecting fragment-based lead discovery at the von Hippel-Lindau protein:hypoxia inducible factor 1α protein-protein interface. Van Molle I Chemistry & biology 2012 PMID: 23102223

Text-mined citations for rs1553620312...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021