Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001267550.2(TTN):c.11312-5194_11312-5162dup

Help
Interpretation:
Benign/Likely benign​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
9 (Most recent: Sep 30, 2021)
Last evaluated:
Aug 1, 2021
Accession:
VCV000047784.13
Variation ID:
47784
Description:
33bp duplication
Help

NM_001267550.2(TTN):c.11312-5194_11312-5162dup

Allele ID
56948
Variant type
Duplication
Variant length
33 bp
Cytogenetic location
2q31.2
Genomic location
2: 178747082-178747083 (GRCh38) GRCh38 UCSC
2: 179611809-179611810 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000002.11:g.179611814_179611846dup
NC_000002.12:g.178747087_178747119dup
NG_011618.3:g.88688_88720dup
... more HGVS
Protein change
-
Other names
p.Thr5102_Glu5112dup
p.Glu5112_Ala5113insThrLeuGluArgTyrSerThrProProGlyGlu
Canonical SPDI
NC_000002.12:178747082:TATCGCTCTAGAGTCTCTCCTGGGGGTGTGGAGTATC:TATCGCTCTAGAGTCTCTCCTGGGGGTGTGGAGTATCGCTCTAGAGTCTCTCCTGGGGGTGTGGAGTATC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA141889
dbSNP: rs397517815
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely benign 4 criteria provided, multiple submitters, no conflicts Jan 17, 2017 RCV000041053.6
Benign/Likely benign 5 criteria provided, multiple submitters, no conflicts Aug 1, 2021 RCV000786262.8
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
TTN Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
7638 17883

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely benign
(Apr 09, 2015)
criteria provided, single submitter
Method: clinical testing
not specified
Allele origin: germline
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine
Accession: SCV000064744.6
Submitted: (Mar 21, 2019)
Evidence details
Comment:
p.Thr5102_Glu5112dup in exon 45A of TTN: This variant is not expected to be clin ically significant because it has been identified in 0.6% (376/66452) European … (more)
Likely benign
(Jan 17, 2017)
criteria provided, single submitter
Method: clinical testing
not specified
Allele origin: germline
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute
Accession: SCV000740483.1
Submitted: (Aug 02, 2017)
Evidence details
Benign
(Oct 23, 2019)
criteria provided, single submitter
Method: clinical testing
Not Provided
Allele origin: germline
GeneDx
Accession: SCV001847297.1
Submitted: (Sep 09, 2021)
Evidence details
Likely benign
(Aug 01, 2021)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
CeGaT Praxis fuer Humangenetik Tuebingen
Accession: SCV001334681.5
Submitted: (Jul 04, 2021)
Evidence details
Uncertain significance
(Jul 27, 2016)
no assertion criteria provided
Method: provider interpretation
not provided
Allele origin: germline
Stanford Center for Inherited Cardiovascular Disease, Stanford University
Accession: SCV000925013.1
Submitted: (Aug 15, 2018)
Evidence details
Comment:
p.Thr5102_Glu5112dup (T5102_E5112dup, c.15285_15317dup33:) in exon 46 of the TTN gene (NM_133379.3, alternate transcript). Seen in a patient in our center with LVNC and reduced systolic … (more)
Likely benign
(-)
no assertion criteria provided
Method: clinical testing
not provided
Allele origin: germline
Human Genetics - Radboudumc,Radboudumc
Additional submitter:
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001953317.1
Submitted: (Sep 30, 2021)
Evidence details
Benign
(-)
no assertion criteria provided
Method: clinical testing
not specified
Allele origin: germline
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center
Additional submitter:
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001975692.1
Submitted: (Sep 21, 2021)
Evidence details
Likely benign
(-)
no assertion criteria provided
Method: clinical testing
not provided
Allele origin: germline
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC)
Study: VKGL Data-share Consensus
Accession: SCV001800155.1
Submitted: (Aug 19, 2021)
Evidence details
Benign
(-)
no assertion criteria provided
Method: clinical testing
not specified
Allele origin: germline
Clinical Genetics,Academic Medical Center
Additional submitter:
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001920706.1
Submitted: (Sep 23, 2021)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs397517815...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021