Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_003000.2(SDHB):c.685_686insCGCTTCACAGAGG (p.Glu229fs)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Mar 28, 2019)
Last evaluated:
Jul 6, 2018
Accession:
VCV000468238.2
Variation ID:
468238
Description:
13bp insertion
Help

NM_003000.2(SDHB):c.685_686insCGCTTCACAGAGG (p.Glu229fs)

Allele ID
447490
Variant type
Insertion
Variant length
13 bp
Cytogenetic location
1p36.13
Genomic location
1: 17022687-17022688 (GRCh38) GRCh38 UCSC
1: 17349182-17349183 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_316:g.36483_36484insCGCTTCACAGAGG
NC_000001.10:g.17349193_17349194insCGCCTCTGTGAAG
NC_000001.11:g.17022698_17022699insCGCCTCTGTGAAG
... more HGVS
Protein change
E229fs
Other names
-
Canonical SPDI
NC_000001.11:17022687:CCTCTGTGAAG:CCTCTGTGAAGCGCCTCTGTGAAG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA521037681
dbSNP: rs1209914140
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Jul 6, 2018 RCV000547430.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
SDHB Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
789 819

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Jul 06, 2018)
criteria provided, single submitter
Method: clinical testing
Gastrointestinal stroma tumor
Paragangliomas 4
Pheochromocytoma
Allele origin: germline
Invitae
Accession: SCV000644764.2
Submitted: (Mar 28, 2019)
Evidence details
Publications
PubMed (1)
Comment:
This sequence change results in a premature translational stop signal in the SDHB gene (p.Glu229Alafs*31). While this is not anticipated to result in nonsense mediated … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Evaluation of SDHB, SDHD and VHL gene susceptibility testing in the assessment of individuals with non-syndromic phaeochromocytoma, paraganglioma and head and neck paraganglioma. Jafri M Clinical endocrinology 2013 PMID: 23072324

Text-mined citations for rs1209914140...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021