Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000363.5(TNNI3):c.485_514del (p.Arg162_Ala171del)

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Oct 5, 2017)
Last evaluated:
Mar 16, 2017
Accession:
VCV000454407.1
Variation ID:
454407
Description:
30bp deletion
Help

NM_000363.5(TNNI3):c.485_514del (p.Arg162_Ala171del)

Allele ID
470247
Variant type
Deletion
Variant length
30 bp
Cytogenetic location
19q13.42
Genomic location
19: 55154065-55154094 (GRCh38) GRCh38 UCSC
19: 55665433-55665462 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_432:g.8639_8668del
LRG_432t1:c.485_514del
LRG_679:g.145_174del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000019.10:55154064:GGGCCCGCAGGTCCAGGGACTCCTTAGCCCGGGCCC:GGGCCC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA658658863
dbSNP: rs1555863489
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter Mar 16, 2017 RCV000551389.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
TNNI3 Little evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
438 493

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Mar 16, 2017)
criteria provided, single submitter
Method: clinical testing
Hypertrophic cardiomyopathy
Allele origin: germline
Invitae
Accession: SCV000623786.1
Submitted: (Oct 05, 2017)
Evidence details
Comment:
This sequence change deletes 30 nucleotides from exon 7 of the TNNI3 mRNA (c.485_514del30). This leads to the deletion of 10 amino acid residues in … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1555863489...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021