VCV000045253.9 - ClinVar

NM_005228.5(EGFR):c.2303_2311dup (p.Ser768_Asp770dup)

Germline

Classification

criteria provided, single submitter. Learn more about how ClinVar calculates review status.

drug response

1 out of 3 submissions contributed to this classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_005228.5(EGFR):c.2303_2311dup (p.Ser768_Asp770dup)

Variation ID: 45253 Accession: VCV000045253.9

Type and length

Duplication, 9 bp

Location

Cytogenetic: 7p11.2 7: 55181309-55181310 (GRCh38) [ NCBI UCSC ] 7: 55249002-55249003 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Jan 30, 2015	Apr 20, 2024	Jun 1, 2012

HGVS

Nucleotide	Protein	Molecular consequence
NM_005228.5:c.2303_2311dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_005219.2:p.Ser768_Asp770dup	inframe insertion
NM_001346897.2:c.2168_2176dup	NP_001333826.1:p.Ser723_Asp725dup	inframe insertion
NM_001346898.2:c.2303_2311dup	NP_001333827.1:p.Ser768_Asp770dup	inframe insertion
NM_001346899.2:c.2168_2176dup	NP_001333828.1:p.Ser723_Asp725dup	inframe insertion
NM_001346900.2:c.2144_2152dup	NP_001333829.1:p.Ser715_Asp717dup	inframe insertion
NM_001346941.2:c.1502_1510dup	NP_001333870.1:p.Ser501_Asp503dup	inframe insertion
NM_005228.3:c.2301_2309dupCAGCGTGGA
NR_047551.1:n.1253_1261dup		non-coding transcript variant
NC_000007.14:g.55181312_55181320dup
NC_000007.13:g.55249005_55249013dup
NG_007726.3:g.167281_167289dup
LRG_304:g.167281_167289dup
LRG_304t1:c.2303_2311dup

... more HGVS ... less HGVS

Protein change

Other names

NC_000007.13:g.55249013_55249014insGCGTGGACA
p.Ser768_Asp770dup
NC_000007.13:g.55249011_55249012insCAGCGTGGA

Canonical SPDI

NC_000007.14:55181309:CAGCGTGGACA:CAGCGTGGACAGCGTGGACA

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA135844 dbSNP: rs397517109 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
EGFR		No evidence available	No evidence available	GRCh38 GRCh37	3562	4011
EGFR-AS1	-	-	-	GRCh38	-	265

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Non-small cell lung carcinoma	Likely pathogenic (1)	no assertion criteria provided	Oct 28, 2006	RCV000038409.5
Tyrosine kinase inhibitor response	drug response (1)	criteria provided, single submitter	Jun 1, 2012	RCV000150613.4
Lung adenocarcinoma	Likely pathogenic (1)	no assertion criteria provided	-	RCV003996406.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	Expand all rows Collapse all rows Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
drug response (Jun 01, 2012) C Contributing to aggregate classification	criteria provided, single submitter (LMM Criteria)	Tyrosine kinase inhibitor response	Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine Accession: SCV000197904.2 First in ClinVar: Feb 02, 2015 Last updated: Feb 02, 2015	Publications: PubMed (1) PubMed: 16187797 Comment: show Ser768_Asp770dup has been reported in the literature in at least four individuals that have been treated with an EGFR tyrosine kinase inhibitor (gefitinib; Wu 2008). Three of these individuals exhibited progressive disease and one individual exhibited partial response as the maximal response. Insertions in exon 20 of EGFR such as this have been associated with resistance to EGFR tyrosine kinase inhibitors in vitro (Greulich 2005). (less) Observation: 1 Collection method: clinical testing Allele origin: somatic Affected status: not provided more Observation 1 Collection method: clinical testing Allele origin: somatic Affected status: not provided Number of individuals with the variant: 6

Likely pathogenic (Oct 28, 2006) N Not contributing to aggregate classification	no assertion criteria provided	Non-Small Cell Lung Cancer	Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine Accession: SCV000062081.2 First in ClinVar: May 03, 2013 Last updated: Jan 30, 2015	Publications: PubMed (1) PubMed: 16187797 Observation: 1 Collection method: clinical testing Allele origin: somatic Affected status: not provided more Observation 1 Collection method: clinical testing Allele origin: somatic Affected status: not provided Number of individuals with the variant: 6

Likely pathogenic (-) N Not contributing to aggregate classification	no assertion criteria provided	Adenocarcinoma of lung	Key Laboratory of Carcinogenesis and Cancer Invasion, Central South University Accession: SCV004042714.1 First in ClinVar: Apr 20, 2024 Last updated: Apr 20, 2024	Observation: 1 Collection method: clinical testing Allele origin: somatic Affected status: yes Observation 1 Collection method: clinical testing Allele origin: somatic Affected status: yes

Comment:

Ser768_Asp770dup has been reported in the literature in at least four individuals that have been treated with an EGFR tyrosine kinase inhibitor (gefitinib; Wu 2008). Three of these individuals exhibited progressive disease and one individual exhibited partial response as the maximal response. Insertions in exon 20 of EGFR such as this have been associated with resistance to EGFR tyrosine kinase inhibitors in vitro (Greulich 2005).

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Oncogenic transformation by inhibitor-sensitive and -resistant EGFR mutants.	Greulich H	PLoS medicine	2005	PMID: 16187797

Text-mined citations for rs397517109 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Mar 05, 2025