Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_005228.5(EGFR):c.2284-5_2290dup

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 29, 2015)
Last evaluated:
Jul 1, 2011
Accession:
VCV000045248.1
Variation ID:
45248
Description:
12bp duplication
Help

NM_005228.5(EGFR):c.2284-5_2290dup

Allele ID
54415
Variant type
Duplication
Variant length
12 bp
Cytogenetic location
7p11.2
Genomic location
7: 55181287-55181288 (GRCh38) GRCh38 UCSC
7: 55248980-55248981 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000007.13:g.55248981_55248992dup
NC_000007.14:g.55181288_55181299dup
NM_005228.5:c.2284-5_2290dup MANE Select splice acceptor
... more HGVS
Protein change
-
Other names
NC_000007.13:g.55248992_55248993insTCCAGGAAGCCT
p.Ala763_Tyr764insPheGlnGluAla
Canonical SPDI
NC_000007.14:55181287:TCCAGGAAGCCT:TCCAGGAAGCCTTCCAGGAAGCCT
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA135833
dbSNP: rs397517106
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Jul 1, 2011 RCV000038404.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
EGFR - - GRCh38
GRCh37
1191 1315
EGFR-AS1 - - - GRCh38 - 107

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Jul 01, 2011)
criteria provided, single submitter
Method: clinical testing
Non-Small Cell Lung Cancer
Allele origin: somatic
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine
Accession: SCV000062076.3
Submitted: (Jan 29, 2015)
Evidence details
Publications
PubMed (1)
Comment:
This variant is a duplication at the 5' intron/exon boundary of exon 20 which results in the insertion of four amino acids. This variant has … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
EGFR somatic doublets in lung cancer are frequent and generally arise from a pair of driver mutations uncommonly seen as singlet mutations: one-third of doublets occur at five pairs of amino acids. Chen Z Oncogene 2008 PMID: 18372921

Text-mined citations for rs397517106...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jul 07, 2021