Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_004448.3(ERBB2):c.2314_2325dup (p.Tyr772_Ala775dup)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Mar 21, 2019)
Last evaluated:
Mar 11, 2011
Accession:
VCV000044985.1
Variation ID:
44985
Description:
12bp duplication
Help

NM_004448.3(ERBB2):c.2314_2325dup (p.Tyr772_Ala775dup)

Allele ID
54152
Variant type
Duplication
Variant length
12 bp
Cytogenetic location
17q12
Genomic location
17: 39724731-39724732 (GRCh38) GRCh38 UCSC
17: 37880984-37880985 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000017.10:g.37880985_37880996dup
NC_000017.11:g.39724732_39724743dup
NM_004448.3:c.2314_2325dup NP_004439.2:p.Tyr772_Ala775dup
... more HGVS
Protein change
-
Other names
p.Tyr772_Ala775dup
Canonical SPDI
NC_000017.11:39724731:TACGTGATGGCT:TACGTGATGGCTTACGTGATGGCT
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA135369
dbSNP: rs397516977
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Mar 11, 2011 RCV000038124.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
ERBB2 - - GRCh38
GRCh37
202 216

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Mar 11, 2011)
criteria provided, single submitter
Method: clinical testing
Non-small cell lung cancer
Allele origin: somatic
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine
Accession: SCV000061790.4
Submitted: (Mar 21, 2019)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs397516977...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jul 07, 2021