Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000117.3(EMD):c.46_82+6del

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 20, 2017)
Last evaluated:
Jul 14, 2016
Accession:
VCV000433168.1
Variation ID:
433168
Description:
43bp deletion
Help

NM_000117.3(EMD):c.46_82+6del

Allele ID
426738
Variant type
Deletion
Variant length
43 bp
Cytogenetic location
Xq28
Genomic location
X: 154379530-154379572 (GRCh38) GRCh38 UCSC
X: 153607890-153607932 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000023.10:g.153607890_153607932del
NC_000023.11:g.154379530_154379572del
NM_000117.3:c.46_82+6del MANE Select splice donor
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000023.11:154379529:CTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGTACGC:
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA645372695
dbSNP: rs1557182198
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Jul 14, 2016 RCV000497779.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
EMD - - GRCh38
GRCh37
285 526

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Jul 14, 2016)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: maternal
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children
Accession: SCV000590857.1
Submitted: (Jan 20, 2017)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1557182198...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jan 25, 2021