Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000179.2(MSH6):c.4053_4081dup (p.Ter1361Leufs)

Help
Interpretation:
Conflicting interpretations of pathogenicity​

Likely pathogenic(1);Uncertain significance(2)

Review status:
criteria provided, conflicting interpretations
Submissions:
3 (Most recent: Jan 7, 2021)
Last evaluated:
Jul 8, 2020
Accession:
VCV000428289.6
Variation ID:
428289
Description:
29bp duplication
Help

NM_000179.2(MSH6):c.4053_4081dup (p.Ter1361Leufs)

Allele ID
419587
Variant type
Duplication
Variant length
29 bp
Cytogenetic location
2p16.3
Genomic location
2: 47806829-47806830 (GRCh38) GRCh38 UCSC
2: 48033969-48033997 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000002.12:g.47806830_47806858dup
NC_000002.11:g.48033968_48033969insTAAATTGCTGACTTTGATTAAGGAATTAT
NM_000179.2:c.4053_4081dup29
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000002.12:47806829:TAAATTGCTGACTTTGATTAAGGAATTAT:TAAATTGCTGACTTTGATTAAGGAATTATTAAATTGCTGACTTTGATTAAGGAATTAT
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA645369290
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter Jul 8, 2020 RCV001040497.2
Conflicting interpretations of pathogenicity 2 criteria provided, conflicting interpretations Jun 17, 2019 RCV000491731.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
MSH6 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
5623 5657

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Feb 28, 2019)
criteria provided, single submitter
Method: clinical testing
Hereditary cancer-predisposing syndrome
Allele origin: germline
Ambry Genetics
Accession: SCV000580103.4
Submitted: (Nov 30, 2020)
Evidence details
Comment:
The c.4053_4081dup29 variant, located in coding exon 10 of the MSH6 gene, results from a duplication of 29 nucleotides at position 4053, causing a translational … (more)
Uncertain significance
(Jul 08, 2020)
criteria provided, single submitter
Method: clinical testing
Hereditary nonpolyposis colorectal neoplasms
Allele origin: germline
Invitae
Accession: SCV001204075.2
Submitted: (Jan 07, 2021)
Evidence details
Comment:
This variant, c.4053_4081dup, disrupts the translational stop signal of MSH6 and is expected to extend the length of the protein by 3 additional amino acid … (more)
Uncertain significance
(Jun 17, 2019)
criteria provided, single submitter
Method: clinical testing
Hereditary cancer-predisposing syndrome
Allele origin: germline
Color Health, Inc
Accession: SCV001348566.1
Submitted: (May 19, 2020)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Mar 22, 2021