Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001145661.2(GATA2):c.1017+513_1017+540del

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
2 (Most recent: Jul 12, 2021)
Last evaluated:
Jul 6, 2021
Accession:
VCV000039587.2
Variation ID:
39587
Description:
28bp deletion
Help

NM_001145661.2(GATA2):c.1017+513_1017+540del

Allele ID
48186
Variant type
Deletion
Variant length
28 bp
Cytogenetic location
3q21.3
Genomic location
3: 128483320-128483347 (GRCh38) GRCh38 UCSC
3: 128202163-128202190 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000003.11:g.128202166_128202193del
NC_000003.12:g.128483323_128483350del
NM_032638.5:c.1017+513_1017+540del MANE Select
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000003.12:128483319:GGCTGCAGATGTCCGGATAGGAAACTCCGGC:GGC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs1553770655
ClinGen: CA130385
dbVar: nssv3761592
dbVar: nsv1067842
OMIM: 137295.0015
Varsome
Comment on variant
28-nt deletion in exon 5 of gene GATA2.
NCBI staff reviewed the sequence information reported in PubMed 22996659 to determine the location of this allele on the current reference sequence. Based on the sequencing in Fig. 1B, the deletion can be mapped to intron 5 as NM_001145661.1:c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC.
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Jul 6, 2021 RCV001541945.1
Pathogenic 1 no assertion criteria provided Oct 1, 2012 RCV000032787.25
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
GATA2 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
813 839

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Jul 06, 2021)
criteria provided, single submitter
Method: curation
GATA2 deficiency with susceptibility to MDS/AML
Lymphedema, primary, with myelodysplasia
(Autosomal dominant inheritance)
Allele origin: germline
Molecular Pathology Research Laboratory,SA Pathology
Accession: SCV001760580.1
Submitted: (Jul 12, 2021)
Evidence details
Publications
PubMed (7)
Comment:
PS3_Supporting, PS4_Moderate, PM1, PM2
Pathogenic
(Oct 01, 2012)
no assertion criteria provided
Method: literature only
IMMUNODEFICIENCY 21
Allele origin: germline
OMIM
Accession: SCV000056555.3
Submitted: (Jan 08, 2013)
Evidence details
Publications
PubMed (1)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
GATA2 deficiency: a protean disorder of hematopoiesis, lymphatics, and immunity. Spinner MA Blood 2014 PMID: 24227816
Acquired ASXL1 mutations are common in patients with inherited GATA2 mutations and correlate with myeloid transformation. West RR Haematologica 2014 PMID: 24077845
GATA2 haploinsufficiency caused by mutations in a conserved intronic element leads to MonoMAC syndrome. Hsu AP Blood 2013 PMID: 23502222
Mutations in GATA2 cause human NK cell deficiency with specific loss of the CD56(bright) subset. Mace EM Blood 2013 PMID: 23365458
Cis-element mutated in GATA2-dependent immunodeficiency governs hematopoiesis and vascular integrity. Johnson KD The Journal of clinical investigation 2012 PMID: 22996659
Autosomal dominant and sporadic monocytopenia with susceptibility to mycobacteria, fungi, papillomaviruses, and myelodysplasia. Vinh DC Blood 2010 PMID: 20040766
Interrupted aortic arch operation in the first week of life: hemodynamic and angiographic evaluation one year later. van der Horst R The Annals of thoracic surgery 1979 PMID: 453969

Text-mined citations for rs1553770655...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jul 26, 2021