Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001110792.2(MECP2):c.1130_1174del (p.Glu377_Pro391del)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Dec 22, 2015)
Last evaluated:
Jul 10, 2015
Accession:
VCV000393486.1
Variation ID:
393486
Description:
45bp deletion
Help

NM_001110792.2(MECP2):c.1130_1174del (p.Glu377_Pro391del)

Allele ID
380321
Variant type
Deletion
Variant length
45 bp
Cytogenetic location
Xq28
Genomic location
X: 154030690-154030734 (GRCh38) GRCh38 UCSC
X: 153296141-153296185 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000023.10:g.153296142_153296186del
NC_000023.11:g.154030691_154030735del
NG_007107.2:g.111394_111438del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000023.11:154030689:CGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGTGCTC:C
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA16609349
dbSNP: rs1064792899
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Jul 10, 2015 RCV000445564.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
MECP2 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
1323 1585

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Jul 10, 2015)
criteria provided, single submitter
Method: clinical testing
Rett syndrome
Allele origin: de novo
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children
Accession: SCV000537182.1
Submitted: (Dec 22, 2015)
Comment:
p.Glu365_Pro379del
Evidence details
Publications
PubMed (1)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Detection of rarely identified multiple mutations in MECP2 gene do not contribute to enhanced severity in Rett syndrome. Chapleau CA American journal of medical genetics. Part A 2013 PMID: 23696494

Text-mined citations for rs1064792899...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021