Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000098.3(CPT2):c.54_72dup (p.Leu25fs)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
3 (Most recent: Nov 23, 2016)
Last evaluated:
Jul 18, 2016
Accession:
VCV000371757.1
Variation ID:
371757
Description:
19bp duplication
Help

NM_000098.3(CPT2):c.54_72dup (p.Leu25fs)

Allele ID
357113
Variant type
Duplication
Variant length
19 bp
Cytogenetic location
1p32.3
Genomic location
1: 53196994-53196995 (GRCh38) GRCh38 UCSC
1: 53662666-53662667 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000001.10:g.53662669_53662687dup
NC_000001.11:g.53196997_53197015dup
NM_000098.3:c.54_72dup MANE Select NP_000089.1:p.Leu25fs frameshift
... more HGVS
Protein change
L25fs
Other names
-
Canonical SPDI
NC_000001.11:53196994:CCGGGAGCCCCCAGTCGGCCC:CCGGGAGCCCCCAGTCGGCCCGGGAGCCCCCAGTCGGCCC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA16040760
dbSNP: rs1057517510
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Jul 18, 2016 RCV000409552.1
Likely pathogenic 1 criteria provided, single submitter Jul 18, 2016 RCV000411079.1
Likely pathogenic 1 criteria provided, single submitter Jul 18, 2016 RCV000412110.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
CPT2 - - GRCh38
GRCh37
484 502

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Jul 18, 2016)
criteria provided, single submitter
Method: clinical testing
Carnitine palmitoyltransferase II deficiency, myopathic, stress-induced
Allele origin: unknown
Counsyl
Accession: SCV000487661.1
Submitted: (Nov 23, 2016)
Evidence details
Likely pathogenic
(Jul 18, 2016)
criteria provided, single submitter
Method: clinical testing
Carnitine palmitoyltransferase II deficiency, infantile
Allele origin: unknown
Counsyl
Accession: SCV000487662.1
Submitted: (Nov 23, 2016)
Evidence details
Likely pathogenic
(Jul 18, 2016)
criteria provided, single submitter
Method: clinical testing
Carnitine palmitoyltransferase II deficiency, lethal neonatal
Allele origin: unknown
Counsyl
Accession: SCV000487663.1
Submitted: (Nov 23, 2016)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1057517510...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Dec 10, 2020