Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_002185.5(IL7R):c.271_280dup (p.Ile94fs)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Aug 18, 2011)
Last evaluated:
Aug 18, 2011
Accession:
VCV000036391.1
Variation ID:
36391
Description:
10bp duplication
Help

NM_002185.5(IL7R):c.271_280dup (p.Ile94fs)

Allele ID
45054
Variant type
Duplication
Variant length
10 bp
Cytogenetic location
5p13.2
Genomic location
5: 35867354-35867355 (GRCh38) GRCh38 UCSC
5: 35867456-35867457 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000005.10:g.35867355_35867364dup
NC_000005.9:g.35867457_35867466dup
NM_002185.5:c.271_280dup MANE Select NP_002176.2:p.Ile94fs frameshift
... more HGVS
Protein change
I94fs
Other names
-
Canonical SPDI
NC_000005.10:35867354:ATATATTTCA:ATATATTTCAATATATTTCA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
dbSNP: rs193922640
ClinGen: CA214042
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Aug 18, 2011 RCV000030060.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
IL7R - - GRCh38
GRCh37
278 301

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
likely pathogenic
(Aug 18, 2011)
criteria provided, single submitter
Method: curation, clinical testing
SCID
(autosomal unknown)
Allele origin: germline
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000052715.1
Submitted: (Aug 18, 2011)
Evidence details
Comment:
Converted during submission to Likely pathogenic.

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs193922640...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jun 14, 2021