Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000016.5(ACADM):c.999_1011dup (p.Gln338Ter)

Help
Interpretation:
Pathogenic/Likely pathogenic​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
6 (Most recent: Jan 7, 2021)
Last evaluated:
Oct 19, 2020
Accession:
VCV000003587.8
Variation ID:
3587
Description:
13bp duplication
Help

NM_000016.5(ACADM):c.999_1011dup (p.Gln338Ter)

Allele ID
18626
Variant type
Duplication
Variant length
13 bp
Cytogenetic location
1p31.1
Genomic location
1: 75761173-75761174 (GRCh38) GRCh38 UCSC
1: 76226858-76226859 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000001.10:g.76226860_76226872dup
NC_000001.11:g.75761175_75761187dup
NM_000016.5:c.999_1011dup NP_000007.1:p.Gln338Ter nonsense
... more HGVS
Protein change
Q149*, Q342*, Q338*, Q371*, Q302*
Other names
-
Canonical SPDI
NC_000001.11:75761173:CTAGAATGAGTTAC:CTAGAATGAGTTACTAGAATGAGTTAC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA252823
OMIM: 607008.0002
dbSNP: rs1225471006
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic/Likely pathogenic 4 criteria provided, multiple submitters, no conflicts Oct 19, 2020 RCV000003770.12
Pathogenic 2 criteria provided, multiple submitters, no conflicts Mar 24, 2017 RCV000478348.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
ACADM - - GRCh38
GRCh37
457 485

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Oct 19, 2020)
criteria provided, single submitter
Method: clinical testing
Medium-chain acyl-coenzyme A dehydrogenase deficiency
Allele origin: germline
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000693964.2
Submitted: (Nov 10, 2020)
Evidence details
Publications
PubMed (3)
Comment:
Variant summary: ACADM c.999_1011dup13 (p.Gln338X) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein … (more)
Likely pathogenic
(Jul 07, 2014)
criteria provided, single submitter
Method: literature only
Medium-chain acyl-coenzyme A dehydrogenase deficiency
(Autosomal recessive inheritance)
Allele origin: unknown
Counsyl
Accession: SCV000220486.1
Submitted: (Mar 11, 2015)
Evidence details
Publications
PubMed (2)
Pathogenic
(Mar 24, 2017)
criteria provided, single submitter
Method: clinical testing
Not Provided
Allele origin: germline
GeneDx
Accession: SCV000568664.4
Submitted: (Jan 29, 2019)
Evidence details
Comment:
The c.999_1011dup13 variant in the ACADM gene was previouslyreported in a MCAD-deficient fibroblast cell line from a patient with MCAD deficiency who harboredanother ACADM variant … (more)
Pathogenic
(Jun 26, 2016)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics
Accession: SCV000343451.3
Submitted: (Nov 03, 2016)
Evidence details
Other databases
http://geneticslab.emory.edu/emv…
Pathogenic
(Feb 18, 2020)
criteria provided, single submitter
Method: clinical testing
Medium-chain acyl-coenzyme A dehydrogenase deficiency
Allele origin: germline
Invitae
Accession: SCV000943707.3
Submitted: (Jan 07, 2021)
Evidence details
Publications
PubMed (3)
Comment:
This sequence change creates a premature translational stop signal (p.Gln338*) in the ACADM gene. It is expected to result in an absent or disrupted protein … (more)
Pathogenic
(Jul 01, 1996)
no assertion criteria provided
Method: literature only
MCAD DEFICIENCY
Allele origin: germline
OMIM
Accession: SCV000023935.2
Submitted: (Dec 30, 2010)
Evidence details
Publications
PubMed (3)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Allelic diversity in MCAD deficiency: the biochemical classification of 54 variants identified during 5 years of ACADM sequencing. Smith EH Molecular genetics and metabolism 2010 PMID: 20434380
Medium-chain acyl-CoA dehydrogenase deficiency in gene-targeted mice. Tolwani RJ PLoS genetics 2005 PMID: 16121256
Prevalence of carriers of the most common medium-chain acyl-CoA dehydrogenase (MCAD) deficiency mutation (G985A) in The Netherlands. de Vries HG Human genetics 1996 PMID: 8682492
Immunochemical characterization of variant medium-chain acyl-CoA dehydrogenase in fibroblasts from patients with medium-chain acyl-CoA dehydrogenase deficiency. Coates PM Pediatric research 1992 PMID: 1594327
Molecular survey of a prevalent mutation, 985A-to-G transition, and identification of five infrequent mutations in the medium-chain Acyl-CoA dehydrogenase (MCAD) gene in 55 patients with MCAD deficiency. Yokota I American journal of human genetics 1991 PMID: 1684086
Molecular basis of medium chain acyl-coenzyme A dehydrogenase deficiency. An A to G transition at position 985 that causes a lysine-304 to glutamate substitution in the mature protein is the single prevalent mutation. Yokota I The Journal of clinical investigation 1990 PMID: 2394825
A new patient with dicarboxylic aciduria suggestive of medium-chain Acyl-CoA dehydrogenase deficiency presenting as Reye's syndrome. Del Valle JA Journal of inherited metabolic disease 1984 PMID: 6434827
http://geneticslab.emory.edu/emvclass/emvclass.php?approved_symbol=ACADM - - - -

Text-mined citations for rs1225471006...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jun 14, 2021