Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_173477.5(USH1G):c.832_851del (p.Ser278fs)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
5 (Most recent: Feb 28, 2018)
Last evaluated:
Nov 28, 2016
Accession:
VCV000002916.3
Variation ID:
2916
Description:
20bp deletion
Help

NM_173477.5(USH1G):c.832_851del (p.Ser278fs)

Allele ID
17955
Variant type
Deletion
Variant length
20 bp
Cytogenetic location
17q25.1
Genomic location
17: 74919985-74920004 (GRCh38) GRCh38 UCSC
17: 72916080-72916099 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NG_033062.1:g.714_733del
NG_033062.2:g.714_733del
NM_001282489.3:c.523_542del NP_001269418.1:p.Ser175fs frameshift
... more HGVS
Protein change
S175fs, S278fs
Other names
-
Canonical SPDI
NC_000017.11:74919984:GAGACGCTGTCCTCGTCCGAGAG:GAG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA340026
OMIM: 607696.0003
dbSNP: rs397515345
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 4 criteria provided, single submitter Nov 28, 2016 RCV000003050.8
Pathogenic 1 no assertion criteria provided May 19, 2016 RCV000216021.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
USH1G - - GRCh38
GRCh37
217 247

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Nov 28, 2016)
criteria provided, single submitter
Method: clinical testing
Usher syndrome, type 1G
Allele origin: biparental
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV000782532.1
Submitted: (Feb 28, 2018)
Evidence details
pathologic
(Jun 20, 2013)
no assertion criteria provided
Method: curation
Usher Syndrome Type I
Allele origin: not provided
GeneReviews
Accession: SCV000087060.1
Submitted: (Apr 30, 2013)
Evidence details
Comment:
Converted during submission to Pathogenic.
Pathogenic
(May 19, 2016)
no assertion criteria provided
Method: literature only
Usher syndrome type 1
Allele origin: germline
GeneReviews
Accession: SCV000268763.1
Submitted: (May 19, 2016)
Evidence details
Publications
PubMed (1)
Other databases
http://www.ncbi.nlm.nih.gov/book…
Pathogenic
(Jun 04, 2016)
no assertion criteria provided
Method: research
Usher syndrome, type 1G
Allele origin: germline
Hereditary Research Laboratory, Bethlehem University
Accession: SCV000538130.1
Submitted: (Jul 28, 2016)
Evidence details
Comment:
profound w/retinitis pigmentosum
Pathogenic
(Mar 01, 2003)
no assertion criteria provided
Method: literature only
USHER SYNDROME, TYPE IG
Allele origin: germline
OMIM
Accession: SCV000023208.3
Submitted: (Dec 30, 2010)
Evidence details
Publications
PubMed (1)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Usher Syndrome Type I Koenekoop RK - 2020 PMID: 20301442
Usher syndrome type I G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Weil D Human molecular genetics 2003 PMID: 12588794
A novel locus for Usher syndrome type I, USH1G, maps to chromosome 17q24-25. Mustapha M Human genetics 2002 PMID: 11941484
http://www.ncbi.nlm.nih.gov/books/NBK1265/ - - - -

Text-mined citations for rs397515345...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021