Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000527.5(LDLR):c.1069_1086dup (p.Glu357_Asp362dup)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
2 (Most recent: Apr 17, 2017)
Last evaluated:
Mar 25, 2016
Accession:
VCV000251648.1
Variation ID:
251648
Description:
18bp duplication
Help

NM_000527.5(LDLR):c.1069_1086dup (p.Glu357_Asp362dup)

Allele ID
245972
Variant type
Duplication
Variant length
18 bp
Cytogenetic location
19p13.2
Genomic location
19: 11111521-11111522 (GRCh38) GRCh38 UCSC
19: 11222198-11222215 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000019.10:g.11111522_11111539dup
NC_000019.9:g.11222198_11222215dup
NM_000527.5:c.1069_1086dup MANE Select NP_000518.1:p.Glu357_Asp362dup
... more HGVS
Protein change
-
Other names
FH Chieti-2
Canonical SPDI
NC_000019.10:11111521:GAGTGTCAGGATCCCGAC:GAGTGTCAGGATCCCGACGAGTGTCAGGATCCCGAC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA10585291
LDLR-LOVD, British Heart Foundation: LDLR_001349
dbSNP: rs879254780
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 2 criteria provided, multiple submitters, no conflicts Mar 25, 2016 RCV000238048.2
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
LDLR Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
3089 3289

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Mar 25, 2016)
criteria provided, single submitter
Method: literature only
Familial hypercholesterolemia
(Autosomal dominant inheritance)
Allele origin: germline
LDLR-LOVD, British Heart Foundation
Accession: SCV000295201.2
Submitted: (Apr 20, 2016)
Evidence details
Publications
PubMed (1)
Likely pathogenic
(Mar 01, 2016)
criteria provided, single submitter
Method: curation, literature only
Familial hypercholesterolemia
(Autosomal dominant inheritance)
Allele origin: germline, not applicable
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge
Accession: SCV000599360.1
Submitted: (Apr 17, 2017)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Analysis of two duplications of the LDL receptor gene affecting intracellular transport, catabolism, and surface binding of the LDL receptor. Patel DD Journal of lipid research 1998 PMID: 9684750

Text-mined citations for rs879254780...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Aug 29, 2020