VCV000226118.2 - ClinVar

NM_152564.5(VPS13B):c.10165_10207del (p.Leu3389fs)

Germline

Classification

criteria provided, single submitter. Learn more about how ClinVar calculates review status.

Pathogenic

This classification is based on the single submission received

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_152564.5(VPS13B):c.10165_10207del (p.Leu3389fs)

Variation ID: 226118 Accession: VCV000226118.2

Type and length

Deletion, 43 bp

Location

Cytogenetic: 8q22.2 8: 99853554-99853596 (GRCh38) [ NCBI UCSC ] 8: 100865782-100865824 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	May 21, 2016	Apr 13, 2025	Mar 1, 2016

HGVS

Nucleotide	Protein	Molecular consequence
NM_152564.5:c.10165_10207del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_689777.3:p.Leu3389fs	frameshift
NM_017890.5:c.10240_10282del MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_060360.3:p.Leu3414fs	frameshift
NC_000008.11:g.99853554_99853596del
NC_000008.10:g.100865782_100865824del
NG_007098.2:g.845289_845331del
LRG_351:g.845289_845331del
LRG_351t2:c.10165_10207del	LRG_351p2:p.Leu3389fs

... more HGVS ... less HGVS

Protein change

L3389fs, L3414fs

Other names

Canonical SPDI

NC_000008.11:99853553:CTCACACTGGACAACATTTTTCTCTGTGTGGCCCCGGGAGCTG:

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA10576250 dbSNP: rs875989882 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
VPS13B		Gene associated with autosomal recessive phenotype	No evidence available	GRCh38 GRCh37	6774	6845

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Cohen syndrome	Pathogenic (1)	criteria provided, single submitter	Mar 1, 2016	RCV000211543.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	Expand all rows Collapse all rows Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Mar 01, 2016) C Contributing to aggregate classification	criteria provided, single submitter (ACMG Guidelines, 2015)	Cohen syndrome	Center of Genomic medicine, Geneva, University Hospital of Geneva Accession: SCV000268520.2 First in ClinVar: May 21, 2016 Last updated: Apr 13, 2025	Comment: show This inherited recessive pathogenic mutation in the VPS13B gene in combination with a second recessive pathogenic mutation in the same gene, NM_152564.4:c.10081dup, was identified in a patient with the Cohen syndrome. (less) Observation: 1 Collection method: clinical testing Allele origin: paternal Affected status: yes more Observation 1 Collection method: clinical testing Allele origin: paternal Affected status: yes Age: 0-9 years Sex: male

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs875989882 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Apr 13, 2025