Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000314.8(PTEN):c.802-51_802-14del

Help
Interpretation:
Benign​

Review status:
reviewed by expert panel FDA Recognized Database
Submissions:
8 (Most recent: Sep 30, 2021)
Last evaluated:
Mar 23, 2020
Accession:
VCV000220416.8
Variation ID:
220416
Description:
38bp deletion
Help

NM_000314.8(PTEN):c.802-51_802-14del

Allele ID
222001
Variant type
Deletion
Variant length
38 bp
Cytogenetic location
10q23.31
Genomic location
10: 87960841-87960878 (GRCh38) GRCh38 UCSC
10: 89720598-89720635 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000010.10:g.89720600_89720637del
NG_007466.2:g.102405_102442del
NM_001304717.5:c.1322-51_1322-14del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000010.11:87960840:TTAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT:TT
Functional consequence
-
Global minor allele frequency (GMAF)
0.02057 (TT)

Allele frequency
-
Links
ClinGen: CA338721
dbSNP: rs557364463
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Benign 2 reviewed by expert panel Mar 23, 2020 RCV001172262.2
Benign 2 criteria provided, single submitter Mar 17, 2017 RCV000508437.7
Benign 1 criteria provided, single submitter Feb 20, 2020 RCV001178034.1
Benign 2 criteria provided, single submitter Mar 28, 2018 RCV001668370.3
Uncertain significance 1 no assertion criteria provided May 26, 2017 RCV000516066.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
PTEN Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh38
GRCh37
2001 2243

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Benign
(Mar 23, 2020)
reviewed by expert panel
Method: curation
PTEN hamartoma tumor syndrome
(Autosomal dominant inheritance)
Allele origin: germline
ClinGen PTEN Variant Curation Expert Panel
FDA Recognized Database
Accession: SCV001335269.1
Submitted: (Mar 30, 2020)
Evidence details
Other databases
https://erepo.clinicalgenome.org…
Comment:
PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID … (more)
Benign
(Mar 17, 2017)
criteria provided, single submitter
Method: clinical testing
not specified
Allele origin: germline
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV000604980.1
Submitted: (Jun 30, 2017)
Evidence details
Benign
(Feb 20, 2020)
criteria provided, single submitter
Method: clinical testing
Hereditary cancer-predisposing syndrome
Allele origin: germline
Color Health, Inc
Accession: SCV001342362.1
Submitted: (May 19, 2020)
Evidence details
Benign
(Nov 30, 2020)
criteria provided, single submitter
Method: clinical testing
PTEN hamartoma tumor syndrome
Allele origin: germline
Invitae
Accession: SCV001724760.1
Submitted: (Jan 07, 2021)
Evidence details
Benign
(Mar 03, 2015)
criteria provided, single submitter
Method: clinical testing
Not Provided
Allele origin: germline
GeneDx
Accession: SCV001883777.1
Submitted: (Sep 16, 2021)
Evidence details
Comment:
This variant is associated with the following publications: (PMID: 11986403)
Benign
(Mar 28, 2018)
criteria provided, single submitter
Method: clinical testing
Not Provided
Allele origin: germline
GeneDx
Accession: SCV000729411.2
Submitted: (Sep 30, 2021)
Evidence details
Uncertain significance
(May 26, 2017)
no assertion criteria provided
Method: research
Cowden syndrome 1
Allele origin: germline
Cancer Genomic Medicine Translational Research Lab,Cleveland Clinic Genomic Medicine Institute
Accession: SCV000579256.1
Submitted: (May 27, 2017)
Evidence details
Publications
PubMed (1)
Likely benign
(-)
no assertion criteria provided
Method: clinical testing
not specified
Allele origin: unknown
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV000692019.1
Submitted: (Oct 31, 2017)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Characterization of cryptic splicing in germline PTEN intronic variants in Cowden syndrome. Chen HJ Human mutation 2017 PMID: 28677221
https://erepo.clinicalgenome.org/evrepo/ui/interpretation/0ac92ea4-6700-459b-b067-82f87dddb118 - - - -

Text-mined citations for rs557364463...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 11, 2021