ClinVar Genomic variation as it relates to human health
NM_000543.5(SMPD1):c.785_807del (p.Leu262fs)
criteria provided, multiple submitters, no conflicts. Learn more about how ClinVar calculates review status.
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000543.5(SMPD1):c.785_807del (p.Leu262fs)
Variation ID: 195086 Accession: VCV000195086.21
- Type and length
-
Deletion, 23 bp
- Location
-
Cytogenetic: 11p15.4 11: 6391846-6391868 (GRCh38) [ NCBI UCSC ] 11: 6413076-6413098 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jun 28, 2015 Jun 29, 2025 Feb 26, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000543.5:c.785_807del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000534.3:p.Leu262fs frameshift NM_000543.4:c.785_807del NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC NM_001007593.3:c.782_804del NP_001007594.2:p.Leu261fs frameshift NM_001318087.2:c.785_807del NP_001305016.1:p.Leu262fs frameshift NM_001318088.2:c.-177_-155del 5 prime UTR NM_001365135.2:c.785_807del NP_001352064.1:p.Leu262fs frameshift NR_027400.3:n.910_932del non-coding transcript variant NC_000011.10:g.6391850_6391872del NC_000011.9:g.6413080_6413102del NG_011780.1:g.6426_6448del - Protein change
- L262fs, L261fs
- Other names
- -
- Canonical SPDI
- NC_000011.10:6391845:AGCCTGTTGAGTGGGCTGGGCCCAGCC:AGCC
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| SMPD1 | - | - |
GRCh38 GRCh37 |
1109 | 1179 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Mar 9, 2020 | RCV000175621.7 | |
| Pathogenic (3) |
criteria provided, single submitter
|
Feb 26, 2024 | RCV000984222.5 | |
| Pathogenic (2) |
criteria provided, single submitter
|
Feb 8, 2021 | RCV000984223.2 | |
| Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Sep 8, 2023 | RCV001065527.8 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Jan 22, 2020 | RCV001248878.3 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
Expand all rows
Collapse all rows
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Mar 09, 2020)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Not Provided |
GeneDx
Accession: SCV001767818.1
First in ClinVar: Aug 07, 2021 Last updated: Aug 07, 2021 |
Comment:
show
Has not been previously published as pathogenic or benign to our knowledge; Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at a significant frequency in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 23418865) (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
|
|
|
Pathogenic
(Jan 22, 2020)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Sphingomyelin/cholesterol lipidosis
(Autosomal recessive inheritance)
|
Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard
Accession: SCV001422554.2
First in ClinVar: Jul 19, 2020 Last updated: Feb 01, 2022 |
Comment:
show
The p.Leu262ArgfsTer4 variant in SMPD1 (also known as p.Leu260ArgfsTer4 due to a difference in cDNA numbering) has been reported in at least 2 individuals with Niemann-Pick disease (PMID: 12712061, 15234149, 12369017, 17011332) and has been identified in 0.008% (2/24384) of African chromosomes and 0.001% (1/128550) of European (non-Finnish) chromosomes the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org; dbSNP rs794727252). Although this variant has been seen in the general population, its frequency is low enough to be consistent with a recessive carrier frequency. This variant has also been reported in ClinVar (VariationID: 195086) as pathogenic by EGL Genetic Diagnostics and as likely pathogenic by Integrated Genetics. This variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at position 262 and leads to a premature termination codon 4 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Loss of function of the SMPD1 gene is an established disease mechanism in autosomal recessive Niemann-Pick disease. The presence of this variant in combination with reported pathogenic variants in 2 individuals with Niemann-Pick disease increases the likelihood that the p.Leu262ArgfsTer4 variant is pathogenic (VariationID: 93315 198093; PMID: 12712061, 15234149, 12369017, 17011332). In summary, this variant meets criteria to be classified as pathogenic for Niemann-Pick disease in an autosomal recessive manner based on the prediction that it causes loss of function, its presence in combination with other pathogenic variants in affected individuals, and its low frequency in the general population. ACMG/AMP Criteria applied: PVS1, PM2, PM3 (Richards 2015). (less)
Observation: 1
Collection method: curation
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: curation
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Oct 02, 2021)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Niemann-Pick disease, type A
Niemann-Pick disease, type B |
Fulgent Genetics, Fulgent Genetics
Accession: SCV002809831.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
Observation: 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
|
|
|
Pathogenic
(Feb 26, 2024)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Niemann-Pick disease, type A |
Baylor Genetics
Accession: SCV004203223.2
First in ClinVar: Dec 30, 2023 Last updated: Jun 17, 2024 |
Observation: 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
|
|
|
Pathogenic
(Apr 27, 2017)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
Eurofins Ntd Llc (ga)
Accession: SCV000227145.6
First in ClinVar: Jun 28, 2015 Last updated: Apr 13, 2025 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Number of individuals with the variant: 3
Zygosity: Single Heterozygote
Sex: mixed
|
|
|
Pathogenic
(Feb 08, 2021)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Niemann-Pick disease, type B |
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000918248.1
First in ClinVar: Jun 02, 2019 Last updated: Jun 02, 2019 |
Comment:
show
Variant summary: SMPD1 c.785_807del23 (p.Leu262ArgfsX4) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant allele was found at a frequency of 4e-06 in 249834 control chromosomes. The variant, c.785_807del23, has not, to our knowledge, been reported in the literature in individuals affected with Niemann-Pick Disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Sep 08, 2023)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Niemann-Pick disease, type B
Niemann-Pick disease, type A
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases. |
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV001230486.6
First in ClinVar: Apr 15, 2020 Last updated: Mar 04, 2025 |
Comment:
show
For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 195086). This variant has not been reported in the literature in individuals affected with SMPD1-related conditions. This variant is present in population databases (rs794727252, gnomAD 0.01%). This sequence change creates a premature translational stop signal (p.Leu262Argfs*4) in the SMPD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SMPD1 are known to be pathogenic (PMID: 12369017, 15221801). (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Aug 03, 2017)
N
Not contributing to aggregate classification
|
no assertion criteria provided
|
Niemann-Pick Disease, Types A/B |
Natera, Inc.
Accession: SCV002091696.1
First in ClinVar: Feb 13, 2022 Last updated: Feb 13, 2022 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Likely pathogenic
(Jan 02, 2014)
N
Not contributing to aggregate classification
|
no assertion criteria provided
|
Niemann-Pick disease, type A |
Counsyl
Accession: SCV001132296.2
First in ClinVar: Dec 23, 2019 Last updated: Jun 29, 2025 |
Comment:
show
This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. (less)
Observation: 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
|
|
|
Likely pathogenic
(Jan 02, 2014)
N
Not contributing to aggregate classification
|
no assertion criteria provided
|
Niemann-Pick disease, type B |
Counsyl
Accession: SCV001132297.2
First in ClinVar: Dec 23, 2019 Last updated: Jun 29, 2025 |
Comment:
show
This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. (less)
Observation: 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
|
|
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Assessment of clinical analytical sensitivity and specificity of next-generation sequencing for detection of simple and complex mutations. | Chin EL | BMC genetics | 2013 | PMID: 23418865 |
| Acid sphingomyelinase deficiency: prevalence and characterization of an intermediate phenotype of Niemann-Pick disease. | Wasserstein MP | The Journal of pediatrics | 2006 | PMID: 17011332 |
| Ocular manifestations of Niemann-Pick disease type B. | McGovern MM | Ophthalmology | 2004 | PMID: 15234149 |
| Screening of 25 Italian patients with Niemann-Pick A reveals fourteen new mutations, one common and thirteen private, in SMPD1. | Ricci V | Human mutation | 2004 | PMID: 15221801 |
| Growth restriction in children with type B Niemann-Pick disease. | Wasserstein MP | The Journal of pediatrics | 2003 | PMID: 12712061 |
| The demographics and distribution of type B Niemann-Pick disease: novel mutations lead to new genotype/phenotype correlations. | Simonaro CM | American journal of human genetics | 2002 | PMID: 12369017 |
| http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=SMPD1 | - | - | - | - |
| https://erepo.clinicalgenome.org/evrepo/ui/interpretation/3e3300a9-81ba-4890-b81f-a13c52d69a15 | - | - | - | - |
Text-mined citations for rs794727252 ...
HelpRecord last updated Jun 29, 2025
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.
