Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_013995.2(LAMP2):c.-26_-15dup

Help
Interpretation:
Uncertain significance​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Feb 11, 2015)
Last evaluated:
Oct 10, 2014
Accession:
VCV000180890.1
Variation ID:
180890
Description:
12bp duplication
Help

NM_013995.2(LAMP2):c.-26_-15dup

Allele ID
179911
Variant type
Duplication
Variant length
12 bp
Cytogenetic location
Xq24
Genomic location
X: 120469183-120469184 (GRCh38) GRCh38 UCSC
X: 119603038-119603039 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_749t2:c.-26_-15dup
LRG_749t1:c.-26_-15dup
NM_001122606.1:c.-26_-15dupGCCGTCGCCGCC 5 prime UTR
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000023.11:120469183:GGCGGCGACGGCGGCG:GGCGGCGACGGCGGCGGCGACGGCGGCG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA333714
dbSNP: rs1556124241
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 1 criteria provided, single submitter Oct 10, 2014 RCV000157988.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
LAMP2 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
450 618

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Oct 10, 2014)
criteria provided, single submitter
Method: clinical testing
Dannon Disease
cardiomyopathy
Allele origin: germline
GeneDx
Accession: SCV000207923.2
Submitted: (Feb 11, 2015)
Evidence details
Comment:
c.-26_-15dupGCCGTCGCCGCC in exon 1 of the LAMP2 gene (NM_001122606.1). The c.-26_-15dupGCCGTCGCCGCC variant in the LAMP2 gene has not been reported as a disease-causing mutation or … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1556124241...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 08, 2021