Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_004448.3(ERBB2):c.2324_2325insCTCCGTGATGGC (p.Gly776_Val777insSerValMetAla)

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Mar 21, 2019)
Last evaluated:
Feb 6, 2014
Accession:
VCV000179590.1
Variation ID:
179590
Description:
12bp insertion
Help

NM_004448.3(ERBB2):c.2324_2325insCTCCGTGATGGC (p.Gly776_Val777insSerValMetAla)

Allele ID
176493
Variant type
Insertion
Variant length
12 bp
Cytogenetic location
17q12
Genomic location
17: 39724733-39724734 (GRCh38) GRCh38 UCSC
17: 37880995-37880996 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000017.10:g.37880995_37880996insCTCCGTGATGGC
NC_000017.11:g.39724742_39724743insCTCCGTGATGGC
NM_001005862.2:c.2234_2235insCTCCGTGATGGC NP_001005862.1:p.Gly746_Val747insSerValMetAla
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000017.11:39724733:CGTGATGGC:CGTGATGGCCTCCGTGATGGC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA184731
dbSNP: rs397516976
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Feb 6, 2014 RCV000156384.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
ERBB2 - - GRCh38
GRCh37
202 216

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely pathogenic
(Feb 06, 2014)
criteria provided, single submitter
Method: clinical testing
Non-small cell lung cancer
Allele origin: somatic
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine
Accession: SCV000206102.3
Submitted: (Mar 21, 2019)
Evidence details
Publications
PubMed (2)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Prevalence, clinicopathologic associations, and molecular spectrum of ERBB2 (HER2) tyrosine kinase mutations in lung adenocarcinomas. Arcila ME Clinical cancer research : an official journal of the American Association for Cancer Research 2012 PMID: 22761469
Lung cancer: intragenic ERBB2 kinase mutations in tumours. Stephens P Nature 2004 PMID: 15457249

Text-mined citations for rs397516976...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Jul 07, 2021