Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_005908.4(MANBA):c.563_572dup (p.Trp192_Gly193insTer)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
2 (Most recent: Mar 6, 2020)
Last evaluated:
Dec 16, 2019
Accession:
VCV000001677.2
Variation ID:
1677
Description:
10bp duplication
Help

NM_005908.4(MANBA):c.563_572dup (p.Trp192_Gly193insTer)

Allele ID
16716
Variant type
Duplication
Variant length
10 bp
Cytogenetic location
4q24
Genomic location
4: 102714538-102714539 (GRCh38) GRCh38 UCSC
4: 103635695-103635696 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NM_005908.3:c.563_572dupTTAGTTGGGA
NC_000004.11:g.103635696_103635705dup
NM_005908.4:c.563_572dup MANE Select NP_005899.3:p.Trp192_Gly193insTer nonsense
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000004.12:102714538:TCCCAACTAA:TCCCAACTAATCCCAACTAA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
The Genome Aggregation Database (gnomAD) 0.00001
Exome Aggregation Consortium (ExAC) 0.00002
The Genome Aggregation Database (gnomAD), exomes 0.00002
Trans-Omics for Precision Medicine (TOPMed) 0.00002
Links
OMIM: 609489.0003
dbSNP: rs752343321
VarSome
Comment on variant
ClinGen staff contributed the HGVS expression for this variant.
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 2 criteria provided, single submitter Dec 16, 2019 RCV000001745.4
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
MANBA - - GRCh38
GRCh37
230 241

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter More information
Pathogenic
(Dec 16, 2019)
criteria provided, single submitter
Method: clinical testing
Beta-D-mannosidosis
Affected status: unknown
Allele origin: germline
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV001363586.1
Submitted: (Mar 06, 2020)
Publications:
PubMed (2)
PubMed: 1972887216401745
Comment:
Variant summary: MANBA c.563_572dup10 (p.Trp192X) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein … (more)
Pathogenic
(Jan 01, 2006)
no assertion criteria provided
Method: literature only
BETA-MANNOSIDOSIS
Affected status: not provided
Allele origin: germline
OMIM
Accession: SCV000021901.2
Submitted: (Dec 30, 2010)
Publications:
PubMed (1)
PubMed: 16401745
Comment on evidence:
In a French patient with beta-mannosidosis (MANSB; 248510), Sedel et al. (2006) identified compound heterozygosity for 2 mutations in the MANBA gene: a 10-bp insertion … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
A MANBA mutation resulting in residual beta-mannosidase activity associated with severe leukoencephalopathy: a possible pseudodeficiency variant. Sabourdy F BMC medical genetics 2009 PMID: 19728872
Atypical Gilles de la Tourette Syndrome with beta-mannosidase deficiency. Sedel F Archives of neurology 2006 PMID: 16401745

Text-mined citations for rs752343321...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Nov 27, 2021