The MECP2 c.1157_1197del, p.Leu386fs variant (rs267608327) is a recurrent deletion found in individuals diagnosed with RETT syndrome (Bienvenu 2002, Chae 2002, Cheadle 2000, Hoffbuhr 2001, Philippe 2006, Ravn 2011, Yaron 2002, Zahorakova 2007), and has associated with both classical disease and a milder form known as the preserved speech variant (Conforti 2002, De Bona 2008, Ravn 2011). It is listed as pathogenic in ClinVar (Variation ID: 143369), but not observed in the general population databases (1000 Genomes Project, Exome Variant Server, Genome Aggregation Database). The variant introduces a frameshift, and is predicted to result in a truncated protein. Based on the above information, the variant is classified as pathogenic. References: Bienvenu T et al. Spectrum of MECP2 mutations in Rett syndrome. Genet Test. 2002; 6(1):1-6. Chae J et al. Mutation analysis of MECP2 and clinical characterization in Korean patients with Rett syndrome. J Child Neurol. 2002; 17(1):33-6. Cheadle J et al. Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. Hum Mol Genet. 2000; 9(7):1119-29. Conforti F et al. Mutation analysis of the MECP2 gene in patients with Rett syndrome. Am J Med Genet A. 2003; 117A(2):184-7. De Bona C et al. Preserved speech variant is allelic of classic Rett syndrome. Eur J Hum Genet. 2000; 8(5):325-30. Hoffbuhr K et al. MeCP2 mutations in children with and without the phenotype of Rett syndrome. Neurology. 2001; 56(11):1486-95. Philippe C et al. Spectrum and distribution of MECP2 mutations in 424 Rett syndrome patients: a molecular update. Eur J Med Genet. 2006; 49(1):9-18. Ravn K et al. Two new Rett syndrome families and review of the literature: expanding the knowledge of MECP2 frameshift mutations. Orphanet J Rare Dis. 2011; 6:58. Yaron Y et al. MECP2 mutations in Israel: implications for molecular analysis, genetic counseling, and prenatal diagnosis in Rett syndrome. Hum Mutat. 2002; 20(4):323-4. Zahorakova D et al. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms. J Hum Genet. 2007; 52(4):342-8.
ClinVar Genomic variation as it relates to human health
NM_001110792.2(MECP2):c.1193_1233del (p.Leu398fs)
Germline
Classification
Help
criteria provided, multiple submitters, no conflicts. Learn more about how ClinVar calculates review status.
Pathogenic/Likely pathogenic
23 out of 29 submissions contributed to this classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
29
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001110792.2(MECP2):c.1193_1233del (p.Leu398fs)
Variation ID: 143369 Accession: VCV000143369.70
- Type and length
-
Deletion, 41 bp
- Location
-
Cytogenetic: Xq28 X: 154030631-154030671 (GRCh38) [ NCBI UCSC ] X: 153296082-153296122 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Aug 17, 2014 Jan 11, 2026 May 28, 2025 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_001110792.2:c.1193_1233del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001104262.1:p.Leu398fs frameshift NM_004992.4:c.1157_1197del MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_004983.1:p.Leu386fs frameshift NM_004992.4:c.1157_1197del41 MANE Plus Clinical Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_001316337.2:c.878_918del NP_001303266.1:p.Leu293fs frameshift NM_001369391.2:c.878_918del NP_001356320.1:p.Leu293fs frameshift NM_001369392.2:c.878_918del NP_001356321.1:p.Leu293fs frameshift NM_001369393.2:c.878_918del NP_001356322.1:p.Leu293fs frameshift NM_001369394.2:c.878_918del NP_001356323.1:p.Leu293fs frameshift NM_001386137.1:c.488_528del NP_001373066.1:p.Leu163fs frameshift NM_001386138.1:c.488_528del NP_001373067.1:p.Leu163fs frameshift NM_001386139.1:c.488_528del NP_001373068.1:p.Leu163fs frameshift NM_004992.3:c.1157_1197del41 NM_004992.3:c.1157_1197delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC NC_000023.11:g.154030636_154030676del NC_000023.10:g.153296087_153296127del NG_007107.3:g.111433_111473del LRG_764:g.111433_111473del LRG_764t1:c.1193_1233del LRG_764p1:p.Leu398fs LRG_764t2:c.1157_1197del LRG_764p2:p.Leu386fs AJ132917.1:c.1157_1197del AJ132917.1:c.1157_1197del41 - Protein change
- L398fs, L293fs, L163fs
- Other names
-
NM_001110792.2(MECP2):c.1193_1233del
p.Leu398fs
p.Leu398Hisfs*5
- Canonical SPDI
- NC_000023.11:154030630:GGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT:GGGGT
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MECP2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
2082 | 2429 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
no assertion criteria provided
|
Mar 1, 2003 | RCV000012592.27 | |
| Pathogenic (7) |
criteria provided, multiple submitters, no conflicts
|
Feb 16, 2025 | RCV000132895.51 | |
| Pathogenic/Likely pathogenic (15) |
criteria provided, multiple submitters, no conflicts
|
May 28, 2025 | RCV000168701.27 | |
| no classifications from unflagged records (1) |
no classifications from unflagged records
|
- | RCV000169930.6 | |
| risk factor (2) |
no assertion criteria provided
|
Mar 1, 2003 | RCV000170099.8 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Jan 6, 2025 | RCV000645107.11 | |
|
See cases
|
Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Nov 11, 2022 | RCV002251999.6 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
Expand all rows
Collapse all rows
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Feb 08, 2013)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
Genetic Services Laboratory, University of Chicago
Accession: SCV000247931.1
First in ClinVar: Oct 05, 2015 Last updated: Oct 05, 2015 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
|
|
|
Pathogenic
(May 16, 2017)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Not Provided |
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV000884100.1
First in ClinVar: Feb 17, 2019 Last updated: Feb 17, 2019 |
Comment:
show
The MECP2 c.1157_1197del, p.Leu386fs variant (rs267608327) is a recurrent deletion found in individuals diagnosed with RETT syndrome (Bienvenu 2002, Chae 2002, Cheadle 2000, Hoffbuhr 2001, Philippe 2006, Ravn 2011, Yaron 2002, Zahorakova 2007), and has associated with both classical disease and a milder form known as the preserved speech variant (Conforti 2002, De Bona 2008, Ravn 2011). It is listed as pathogenic in ClinVar (Variation ID: 143369), but not observed in the general population databases (1000 Genomes Project, Exome Variant Server, Genome Aggregation Database). The variant introduces a frameshift, and is predicted to result in a truncated protein. Based on the above information, the variant is classified as pathogenic. References: Bienvenu T et al. Spectrum of MECP2 mutations in Rett syndrome. Genet Test. 2002; 6(1):1-6. Chae J et al. Mutation analysis of MECP2 and clinical characterization in Korean patients with Rett syndrome. J Child Neurol. 2002; 17(1):33-6. Cheadle J et al. Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. Hum Mol Genet. 2000; 9(7):1119-29. Conforti F et al. Mutation analysis of the MECP2 gene in patients with Rett syndrome. Am J Med Genet A. 2003; 117A(2):184-7. De Bona C et al. Preserved speech variant is allelic of classic Rett syndrome. Eur J Hum Genet. 2000; 8(5):325-30. Hoffbuhr K et al. MeCP2 mutations in children with and without the phenotype of Rett syndrome. Neurology. 2001; 56(11):1486-95. Philippe C et al. Spectrum and distribution of MECP2 mutations in 424 Rett syndrome patients: a molecular update. Eur J Med Genet. 2006; 49(1):9-18. Ravn K et al. Two new Rett syndrome families and review of the literature: expanding the knowledge of MECP2 frameshift mutations. Orphanet J Rare Dis. 2011; 6:58. Yaron Y et al. MECP2 mutations in Israel: implications for molecular analysis, genetic counseling, and prenatal diagnosis in Rett syndrome. Hum Mutat. 2002; 20(4):323-4. Zahorakova D et al. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms. J Hum Genet. 2007; 52(4):342-8. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(May 28, 2019)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
Mendelics
Accession: SCV001142080.1
First in ClinVar: Jan 09, 2020 Last updated: Jan 09, 2020 |
Observation: 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
|
|
|
Pathogenic
(Mar 24, 2021)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
See cases
|
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein
Accession: SCV002523061.1
First in ClinVar: Jun 09, 2022 Last updated: Jun 09, 2022 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Clinical Features:
Neurodevelopmental abnormality (present) , Autistic behavior (present) , Abnormal facial shape (present)
|
|
|
Pathogenic
(Mar 17, 2016)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology
Study: CSER-HudsonAlpha
Accession: SCV000281761.4 First in ClinVar: Oct 05, 2015 Last updated: Dec 24, 2022 |
Observation 1
Collection method: research
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Clinical Features:
Generalized hypotonia (present) , Abnormal facial shape (present)
|
|
|
Pathogenic
(Mar 24, 2022)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Not Provided |
GeneDx
Accession: SCV000330363.8
First in ClinVar: Dec 06, 2016 Last updated: Mar 04, 2023 |
Comment:
show
Frameshift variant predicted to result in protein truncation in a gene for which loss-of-function is a known mechanism of disease; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 26984561, 16473305, 10767337, 11746022, 17142618, 21878110, 23810759, 17387578, 11402105, 21160487, 33168794, 31943886, 34876818, 34782041, 32105570, 32631363) (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
|
|
|
Pathogenic
(Aug 15, 2023)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
Baylor Genetics
Accession: SCV004041448.1
First in ClinVar: Oct 07, 2023 Last updated: Oct 07, 2023 |
Observation: 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
|
|
|
Pathogenic
(Mar 22, 2024)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome
(X-linked inheritance)
|
Centre for Population Genomics, CPG
Accession: SCV004808877.1
First in ClinVar: Apr 06, 2024 Last updated: Apr 06, 2024 |
Comment:
show
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (ClinVar Variation ID: 143369 PMID:11269512 , PMID:23810759 , PMID:23696494 , PMID:21878110 , PMID:20031356 ). This variant is absent from gnomAD (PM2_Supporting). (less)
Observation: 1
Collection method: curation
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: curation
Allele origin: germline
Affected status: unknown
|
|
|
pathogenic
(Nov 18, 2024)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
Quest Diagnostics Nichols Institute San Juan Capistrano
Accession: SCV005625021.1
First in ClinVar: Jan 19, 2025 Last updated: Jan 19, 2025 |
Comment:
show
The MECP2 c.1157_1197del (p.Leu386Hisfs*5) variant alters the translational reading frame of the MECP2 mRNA and causes the premature termination of MECP2 protein synthesis. This variant is not expected to cause loss of protein expression through nonsense-mediated decay. However, it disrupts a substantial portion of the protein, and therefore, is expected to disrupt function. This variant has been reported in the published literature in multiple individuals affected with Rett Syndrome (PMID: 10767337 (2000), 11241840 (2011), 15526954 (2004), 16473305 (2006), 23696494 (2013), 23810759 (2013)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: unknown
|
|
|
Pathogenic
(Jan 06, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Severe neonatal-onset encephalopathy with microcephaly |
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000766849.7
First in ClinVar: May 28, 2018 Last updated: Feb 25, 2025 |
Comment:
show
This sequence change creates a premature translational stop signal (p.Leu386Hisfs*5) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Rett syndrome (PMID: 10767337, 11746022, 11913567, 12325033, 16473305, 17089071, 17142618, 17387578, 19914908, 21878110). In at least one individual the variant was observed to be de novo. It has also been observed to segregate with disease in related individuals. This variant is also known as c.1157_1197del41 and c.1157del41. ClinVar contains an entry for this variant (Variation ID: 143369). For these reasons, this variant has been classified as Pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Jan 12, 2018)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
Eurofins Ntd Llc (ga)
Accession: SCV000230276.6
First in ClinVar: Jun 28, 2015 Last updated: Apr 13, 2025 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Number of individuals with the variant: 2
Zygosity: Single Heterozygote
Sex: mixed
|
|
|
Pathogenic
(Nov 02, 2016)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
Medical Molecular Genetics Department, National Research Center
Accession: SCV000492506.2
First in ClinVar: Mar 16, 2017 Last updated: Apr 13, 2025
Comment:
Heterozygous - novel
|
Observation 1
Collection method: clinical testing
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Geographic origin: North Africa/Egypt
|
|
|
Pathogenic
(Jun 30, 2015)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
Molecular Diagnostics Lab, Nemours Children's Health, Delaware
Accession: SCV000537169.2
First in ClinVar: Mar 16, 2017 Last updated: Apr 13, 2025
Comment:
p.Leu386Hisfs*4
|
Observation 1
Collection method: clinical testing
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Age: 0-9 years
Sex: female
|
|
|
Pathogenic
(Aug 31, 2017)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome
(X-linked inheritance)
|
Undiagnosed Diseases Network, NIH
Study: Undiagnosed Diseases Network (NIH), UDN
Accession: SCV000746598.2 First in ClinVar: Mar 16, 2017 Last updated: Apr 13, 2025 |
Comment:
show
41 base pair deletion resulting in a frameshift, which is predicted to result in loss of function in the MECP2 gene, where loss of function is a known mechanism of Rett syndrome. This variant has been observed in multiple, unrelated, affected individuals with Rett syndrome (PMID: 12673788) (less)
Observation 1
Collection method: clinical testing
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Clinical Features:
Thyroiditis (present) , Scoliosis (present) , Recurrent respiratory infections (present) , Postnatal microcephaly (present) , Poor coordination (present) , Pes planus (present) , Moderate global developmental delay (present) , Maternal anticardiolipin antibody positive (present) , Loss of speech (present) , Intention tremor (present) , Head titubation (present) , Gait imbalance (present) , Developmental regression (present) , Central hypotonia (present) , Brisk reflexes (present) , Breathing dysregulation (present) , Autistic disorder of childhood onset (present) , Cerebellar ataxia (present) , Appendicular hypotonia (present)
Test name: HA clinical genome
Zygosity: Single Heterozygote
Age: 0-9 years
Sex: female
Ethnicity/Population group: Puerto Rican
Platform type: genome sequencing
Platform name: HiSeq
Testing laboratory: HudsonAlpha Clinical Services Lab, LLC, HudsonAlpha Clinical Services Lab, LLC
Date variant was reported to submitter: 2017-08-31
Testing laboratory interpretation: Pathogenic
|
|
|
Pathogenic
(Nov 11, 2022)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
see cases
|
Institute of Human Genetics, University Hospital Muenster
Accession: SCV003804920.2
First in ClinVar: Mar 04, 2023 Last updated: Apr 13, 2025 |
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Clinical Features:
Global developmental delay (present)
Zygosity: Single Heterozygote
Age: 0-9 years
Sex: female
Tissue: blood
Platform type: next-gen sequencing
Platform name: NovaSeq 6000
|
|
|
Pathogenic
(Nov 14, 2024)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome
(X-linked dominant inheritance)
|
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics
Accession: SCV005439121.2
First in ClinVar: Dec 28, 2024 Last updated: Apr 13, 2025 |
Comment:
show
A heterozygous 41 base pair deletion in exon 3 of the MECP2 gene that results in a frameshift and premature truncation of the protein 5 amino acids downstream to codon 398 (p.Leu398Hisfs*5; ENST00000453960.7) was detected. This variant has not been reported in the 1000 genomes and gnomAD databases. The in silico prediction of the variant is damaging MutationTaster2. This variant has been previously reported in the ClinVar database as pathogenic (SCV003804920.1). In summary, the variant meets our criteria to be classified as pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Clinical Features:
Absent speech (present) , Inability to walk (present) , No social interaction (present) , Hypotonia (present)
Zygosity: Single Heterozygote
Age: 0-9 years
Sex: female
Platform type: Next-generation sequencing
Platform name: Illumina sequencing platform
Method: DNA was used to perform targeted gene capture using a custom capture kit. Libraries were sequenced to mean >80-100X coverage on the Illumina sequencing platform. Sequence obtained were aligned to human references genome using BWA program and analyzed using Picard and GATK-Lite toolkit to identify variants in the targeted genes relevant to clinical indication
|
|
|
Pathogenic
(Mar 07, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000698531.2
First in ClinVar: Mar 16, 2017 Last updated: May 03, 2025 |
Comment:
show
Variant summary: MECP2 c.1157_1197del41 (p.Leu386HisfsX5) results in a premature termination codon. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. The variant was absent in 176656 control chromosomes. c.1157_1197del41 has been reported in the literature in multiple individuals affected with Rett Syndrome. These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 15173251, 17142618, 23810759, 21878110). ClinVar contains an entry for this variant (Variation ID: 143369). Based on the evidence outlined above, the variant was classified as pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(May 28, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome
(X-linked dominant inheritance)
|
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen
Accession: SCV006081273.1
First in ClinVar: May 31, 2025 Last updated: May 31, 2025 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Clinical Features:
Delayed speech and language development (present) , Global developmental delay (present) , Motor delay (present) , Pes planus (present) , Expressive language delay (present) , Bruxism (present) , Structural foot deformity (present) , Stereotypical hand wringing (present)
|
|
|
Pathogenic
(Feb 16, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
Laboratory of Genetics, Children's Clinical University Hospital Latvia
Accession: SCV006105577.1
First in ClinVar: Jul 05, 2025 Last updated: Jul 05, 2025 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
|
|
|
Pathogenic
(May 01, 2021)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
not provided |
CeGaT Center for Human Genetics Tuebingen
Accession: SCV001747675.29
First in ClinVar: Jul 10, 2021 Last updated: Jan 11, 2026 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Number of individuals with the variant: 1
|
|
|
Likely pathogenic
(Apr 22, 2022)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome |
Institute of Human Genetics, Clinical Exome/Genome Diagnostics Group, University Hospital Bonn
Accession: SCV002525929.1
First in ClinVar: Jun 18, 2022 Last updated: Jun 18, 2022 |
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
|
|
|
Pathogenic
(May 20, 2023)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome
(X-linked dominant inheritance)
|
Neuberg Centre For Genomic Medicine, NCGM
Accession: SCV005382398.1
First in ClinVar: Oct 26, 2024 Last updated: Oct 26, 2024 |
Comment:
show
The frameshift variant c.1193_1233del (p.Leu398HisfsTer5) in the MECP2 gene has been reported previously in individuals affected with Rett Syndrome (Chapleau et al., 2013; Ravn et al., 2011). This variant is absent in the gnomAD Exomes. It is submitted to ClinVar as Likely Pathogenic/ Pathogenic (multiple submitters). This variant is predicted to cause a loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: yes
Clinical Features:
Upper motor neuron dysfunction (present)
Comment on clinical features:
Consanguinity- Absent Clinical presentation- Global developmental delay predominantly speech delay, regression, drooling, and involuntary hand movements. Clinical suspicion- MECP2 gene analysis.
|
|
|
Pathogenic
(Mar 04, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Rett syndrome
(X-linked dominant inheritance)
|
Institute of Human Genetics, University of Leipzig Medical Center
Accession: SCV005900071.2
First in ClinVar: Mar 29, 2025 Last updated: Apr 13, 2025 |
Observation 1
Collection method: clinical testing
Allele origin: unknown
Affected status: yes
Clinical Features:
Motor delay (present) , Delayed speech and language development (present) , Moderate global developmental delay (present)
Sex: female
|
|
|
Pathogenic
(Mar 01, 2003)
N
Not contributing to aggregate classification
|
no assertion criteria provided
|
RETT SYNDROME, ZAPPELLA VARIANT |
OMIM
Accession: SCV000032827.4
First in ClinVar: Apr 04, 2013 Last updated: Dec 15, 2018 |
Observation: 1
Collection method: literature only
Allele origin: germline
Affected status: not provided
Observation 1
Collection method: literature only
Allele origin: germline
Affected status: not provided
Comment on evidence:
Rett Syndrome, Zappella Variant In a patient with Zappella variant, also known as preserved speech variant, Rett syndrome (see 312750), De Bona et al. (2000) … (more)
Rett Syndrome, Zappella Variant In a patient with Zappella variant, also known as preserved speech variant, Rett syndrome (see 312750), De Bona et al. (2000) found a 41-bp deletion in the MECP2 gene beginning at nucleotide 1157. The DNA deletion resulted in a deletion of 14 amino acids beginning with codon 386 with a frameshift and stop codon at 404. Autism, Susceptibility to, X-Linked 3 Carney et al. (2003) identified a female with classic autism disorder (AUTSX3; 300496) who had this mutation in MECP2. She had virtually none of the diagnostic criteria for Rett syndrome. Analysis of X chromosome inactivation in blood leukocytes showed borderline skewing, with a 31% pattern. (less)
|
|
|
risk factor
(Mar 01, 2003)
N
Not contributing to aggregate classification
|
no assertion criteria provided
|
AUTISM, SUSCEPTIBILITY TO, X-LINKED 3 |
OMIM
Accession: SCV000032828.4
First in ClinVar: Apr 04, 2013 Last updated: Dec 15, 2018 |
Observation: 1
Collection method: literature only
Allele origin: germline
Affected status: not provided
Observation 1
Collection method: literature only
Allele origin: germline
Affected status: not provided
Comment on evidence:
Rett Syndrome, Zappella Variant In a patient with Zappella variant, also known as preserved speech variant, Rett syndrome (see 312750), De Bona et al. (2000) … (more)
Rett Syndrome, Zappella Variant In a patient with Zappella variant, also known as preserved speech variant, Rett syndrome (see 312750), De Bona et al. (2000) found a 41-bp deletion in the MECP2 gene beginning at nucleotide 1157. The DNA deletion resulted in a deletion of 14 amino acids beginning with codon 386 with a frameshift and stop codon at 404. Autism, Susceptibility to, X-Linked 3 Carney et al. (2003) identified a female with classic autism disorder (AUTSX3; 300496) who had this mutation in MECP2. She had virtually none of the diagnostic criteria for Rett syndrome. Analysis of X chromosome inactivation in blood leukocytes showed borderline skewing, with a 31% pattern. (less)
|
|
|
Pathogenic
(Dec 05, 2013)
N
Not contributing to aggregate classification
|
no assertion criteria provided
|
Rett syndrome |
RettBASE
Accession: SCV000222420.2
First in ClinVar: Apr 24, 2015 Last updated: Apr 13, 2025 |
Observation:
37
Observation 1
Collection method: curation
Allele origin: unknown
Affected status: unknown
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Not known
Observation 2
Collection method: curation
Allele origin: unknown
Affected status: unknown
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Not known
Observation 3
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: not stated
Comment on evidence:
Not Rett synd. - Rett-like
Observation 4
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: Blood
Comment on evidence:
Rett syndrome - Classical
Observation 5
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - Classical
Observation 6
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 7
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: Blood
Comment on evidence:
Rett syndrome - Not certain
Observation 8
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Comment on evidence:
Rett syndrome - Not certain
Observation 9
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: Blood
Comment on evidence:
Rett syndrome - Preserved speech
Observation 10
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: Blood
Comment on evidence:
Rett syndrome - Not certain
Observation 11
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 12
Collection method: curation
Allele origin: maternal
Affected status: yes
Number of individuals with the variant: 1
Family history: Yes
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - classical
Observation 13
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - classical
Observation 14
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 15
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - atypical
Observation 16
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 17
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Tissue: Blood
Comment on evidence:
Rett syndrome - Not certain
Observation 18
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: Blood or skin
Comment on evidence:
Rett syndrome - Classical
Observation 19
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - Classical
Observation 20
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Comment on evidence:
Rett syndrome - Preserved speech
Observation 21
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: Blood
Comment on evidence:
Rett syndrome - Classical
Observation 22
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Tissue: Blood
Comment on evidence:
Rett syndrome - Not certain
Observation 23
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: Blood
Comment on evidence:
Rett syndrome - Classical
Observation 24
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: Blood or skin
Comment on evidence:
Rett syndrome - Classical
Observation 25
Collection method: curation
Allele origin: maternal
Affected status: yes
Number of individuals with the variant: 1
Family history: Yes
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - atypical
Observation 26
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - atypical
Observation 27
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - Classical
Observation 28
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 29
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 30
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 31
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: Blood
Comment on evidence:
Rett syndrome - Not certain
Observation 32
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Tissue: Blood
Comment on evidence:
Rett syndrome - Not certain
Observation 33
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 34
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
Observation 35
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: NK
Comment on evidence:
Rett syndrome - preserved speech
Observation 36
Collection method: curation
Allele origin: de novo
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - classical
Observation 37
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Sex: female
Tissue: blood
Comment on evidence:
Rett syndrome - not certain
|
|
|
not provided
(-)
N
Not contributing to aggregate classification
|
Flagged submission
flagged submission
Reason: This record appears to be redundant with a more recent record from the same submitter.
Notes: SCV000187875 appears to be redundant with SCV000222420.
(less)
Notes: SCV000187875 appears to
(...more)
Source: NCBI
|
not provided |
RettBASE
Accession: SCV000187875.1
First in ClinVar: Aug 17, 2014 Last updated: Aug 17, 2014 |
Observation: 1
Collection method: not provided
Allele origin: unknown
Affected status: not provided
Observation 1
Collection method: not provided
Allele origin: unknown
Affected status: not provided
|
|
|
Pathogenic
(Dec 05, 2013)
N
Not contributing to aggregate classification
|
Flagged submission
flagged submission
Reason: This record appears to be redundant with a more recent record from the same submitter.
Notes: SCV000187876 appears to be redundant with SCV000222420.
(less)
Notes: SCV000187876 appears to
(...more)
Source: NCBI
|
Mental retardation, X-linked, syndromic 13 |
RettBASE
Accession: SCV000187876.3
First in ClinVar: Aug 17, 2014 Last updated: Apr 13, 2025 |
Observation 1
Collection method: curation
Allele origin: germline
Affected status: yes
Number of individuals with the variant: 1
Family history: Yes
Sex: female
Tissue: blood
Comment on evidence:
Not Rett synd. - mental retardation
|
|
|
Pathogenic
(Dec 05, 2013)
N
Not contributing to aggregate classification
|
Flagged submission
flagged submission
Reason: This record appears to be redundant with a more recent record from the same submitter.
Notes: SCV000222419 appears to be redundant with SCV000222420.
(less)
Notes: SCV000222419 appears to
(...more)
Source: NCBI
|
Austism susceptibility, X-linked |
RettBASE
Accession: SCV000222419.2
First in ClinVar: Apr 22, 2015 Last updated: Apr 13, 2025 |
Observation 1
Collection method: curation
Allele origin: unknown
Affected status: yes
Number of individuals with the variant: 1
Family history: No
Sex: female
Tissue: blood
Comment on evidence:
Not Rett synd. - autism only
|
|
| Flagged submissions do not contribute to the aggregate classification or review status for the variant. Learn more | |||||
Comment:
Comment:
ACMG classification criteria: PVS1, PS4, PM2, PM6
Comment:
Frameshift variant predicted to result in protein truncation in a gene for which loss-of-function is a known mechanism of disease; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 26984561, 16473305, 10767337, 11746022, 17142618, 21878110, 23810759, 17387578, 11402105, 21160487, 33168794, 31943886, 34876818, 34782041, 32105570, 32631363)
Comment:
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (ClinVar Variation ID: 143369 PMID:11269512 , PMID:23810759 , PMID:23696494 , PMID:21878110 , PMID:20031356 ). This variant is absent from gnomAD (PM2_Supporting).
Comment:
The MECP2 c.1157_1197del (p.Leu386Hisfs*5) variant alters the translational reading frame of the MECP2 mRNA and causes the premature termination of MECP2 protein synthesis. This variant is not expected to cause loss of protein expression through nonsense-mediated decay. However, it disrupts a substantial portion of the protein, and therefore, is expected to disrupt function. This variant has been reported in the published literature in multiple individuals affected with Rett Syndrome (PMID: 10767337 (2000), 11241840 (2011), 15526954 (2004), 16473305 (2006), 23696494 (2013), 23810759 (2013)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic.
Comment:
This sequence change creates a premature translational stop signal (p.Leu386Hisfs*5) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Rett syndrome (PMID: 10767337, 11746022, 11913567, 12325033, 16473305, 17089071, 17142618, 17387578, 19914908, 21878110). In at least one individual the variant was observed to be de novo. It has also been observed to segregate with disease in related individuals. This variant is also known as c.1157_1197del41 and c.1157del41. ClinVar contains an entry for this variant (Variation ID: 143369). For these reasons, this variant has been classified as Pathogenic.
Comment:
41 base pair deletion resulting in a frameshift, which is predicted to result in loss of function in the MECP2 gene, where loss of function is a known mechanism of Rett syndrome. This variant has been observed in multiple, unrelated, affected individuals with Rett syndrome (PMID: 12673788)
Comment:
ACMG categories: PVS1,PM1,PM2,PP5
Comment:
A heterozygous 41 base pair deletion in exon 3 of the MECP2 gene that results in a frameshift and premature truncation of the protein 5 amino acids downstream to codon 398 (p.Leu398Hisfs*5; ENST00000453960.7) was detected. This variant has not been reported in the 1000 genomes and gnomAD databases. The in silico prediction of the variant is damaging MutationTaster2. This variant has been previously reported in the ClinVar database as pathogenic (SCV003804920.1). In summary, the variant meets our criteria to be classified as pathogenic.
Comment:
Variant summary: MECP2 c.1157_1197del41 (p.Leu386HisfsX5) results in a premature termination codon. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. The variant was absent in 176656 control chromosomes. c.1157_1197del41 has been reported in the literature in multiple individuals affected with Rett Syndrome. These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 15173251, 17142618, 23810759, 21878110). ClinVar contains an entry for this variant (Variation ID: 143369). Based on the evidence outlined above, the variant was classified as pathogenic.
Comment:
The frameshift variant c.1193_1233del (p.Leu398HisfsTer5) in the MECP2 gene has been reported previously in individuals affected with Rett Syndrome (Chapleau et al., 2013; Ravn et al., 2011). This variant is absent in the gnomAD Exomes. It is submitted to ClinVar as Likely Pathogenic/ Pathogenic (multiple submitters). This variant is predicted to cause a loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease-causing. For these reasons, this variant has been classified as Pathogenic.
Comment:
Criteria applied: PVS1,PS4,PM2,PS2_SUP
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| MECP2 gene study in a large cohort: testing of 240 female patients and 861 healthy controls (519 females and 342 males). | Maortua H | The Journal of molecular diagnostics : JMD | 2013 | PMID: 23810759 |
| Detection of rarely identified multiple mutations in MECP2 gene do not contribute to enhanced severity in Rett syndrome. | Chapleau CA | American journal of medical genetics. Part A | 2013 | PMID: 23696494 |
| Genetic and epileptic features in Rett syndrome. | Kim HJ | Yonsei medical journal | 2012 | PMID: 22476991 |
| Two new Rett syndrome families and review of the literature: expanding the knowledge of MECP2 frameshift mutations. | Ravn K | Orphanet journal of rare diseases | 2011 | PMID: 21878110 |
| Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations. | Hadzsiev K | Journal of human genetics | 2011 | PMID: 21160487 |
| Identification and characterization of novel sequence variations in MECP2 gene in Rett syndrome patients. | Monnerat LS | Brain & development | 2010 | PMID: 20031356 |
| Updating the profile of C-terminal MECP2 deletions in Rett syndrome. | Bebbington A | Journal of medical genetics | 2010 | PMID: 19914908 |
| Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms. | Zahorakova D | Journal of human genetics | 2007 | PMID: 17387578 |
| MECP2 and CDKL5 gene mutation analysis in Chinese patients with Rett syndrome. | Li MR | Journal of human genetics | 2007 | PMID: 17089071 |
| Comprehensive diagnosis of Rett's syndrome relying on genetic, epigenetic and expression evidence of deficiency of the methyl-CpG-binding protein 2 gene: study of a cohort of Israeli patients. | Petel-Galil Y | Journal of medical genetics | 2006 | PMID: 17142618 |
| A new cohort of MECP2 mutation screening in unexplained mental retardation: careful re-evaluation is the best indicator for molecular diagnosis. | Donzel-Javouhey A | American journal of medical genetics. Part A | 2006 | PMID: 16763963 |
| Spectrum and distribution of MECP2 mutations in 424 Rett syndrome patients: a molecular update. | Philippe C | European journal of medical genetics | 2006 | PMID: 16473305 |
| Influence of MECP2 gene mutation and X-chromosome inactivation on the Rett syndrome phenotype. | Chae JH | Journal of child neurology | 2004 | PMID: 15526954 |
| Mutation analysis of MECP2 and determination of the X-inactivation pattern in Hungarian Rett syndrome patients. | Kárteszi J | American journal of medical genetics. Part A | 2004 | PMID: 15389714 |
| Screening of MECP2 coding sequence in patients with phenotypes of decreasing likelihood for Rett syndrome: a cohort of 171 cases. | Kammoun F | Journal of medical genetics | 2004 | PMID: 15173251 |
| Identification of MeCP2 mutations in a series of females with autistic disorder. | Carney RM | Pediatric neurology | 2003 | PMID: 12770674 |
| Mutation analysis of the MECP2 gene in patients with Rett syndrome. | Conforti FL | American journal of medical genetics. Part A | 2003 | PMID: 12567420 |
| MECP2 mutations in Israel: implications for molecular analysis, genetic counseling, and prenatal diagnosis in Rett syndrome. | Yaron Y | Human mutation | 2002 | PMID: 12325033 |
| Spectrum of MECP2 mutations in Rett syndrome. | Bienvenu T | Genetic testing | 2002 | PMID: 12180070 |
| Mutation analysis of MECP2 and clinical characterization in Korean patients with Rett syndrome. | Chae JH | Journal of child neurology | 2002 | PMID: 11913567 |
| Preserved speech variants of the Rett syndrome: molecular and clinical analysis. | Zappella M | American journal of medical genetics | 2001 | PMID: 11746022 |
| Spectrum and distribution of MECP2 mutations in 64 Italian Rett syndrome girls: tentative genotype/phenotype correlation. | Giunti L | Brain & development | 2001 | PMID: 11738883 |
| DHPLC analysis of the MECP2 gene in Italian Rett patients. | Nicolao P | Human mutation | 2001 | PMID: 11462237 |
| MeCP2 mutations in children with and without the phenotype of Rett syndrome. | Hoffbuhr K | Neurology | 2001 | PMID: 11402105 |
| Mutation analysis of the MECP2 gene in British and Italian Rett syndrome females. | Vacca M | Journal of molecular medicine (Berlin, Germany) | 2001 | PMID: 11269512 |
| Mutation spectrum in patients with Rett syndrome in the German population: Evidence of hot spot regions. | Laccone F | Human mutation | 2001 | PMID: 11241840 |
| Spectrum of mutations in the MECP2 gene in patients with infantile autism and Rett syndrome. | Lam CW | Journal of medical genetics | 2000 | PMID: 11106359 |
| Preserved speech variant is allelic of classic Rett syndrome. | De Bona C | European journal of human genetics : EJHG | 2000 | PMID: 10854091 |
| Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. | Cheadle JP | Human molecular genetics | 2000 | PMID: 10767337 |
| http://mecp2.chw.edu.au/ | - | - | - | - |
| http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=MECP2 | - | - | - | - |
| https://erepo.clinicalgenome.org/evrepo/ui/interpretation/a73dfdb3-a704-4a10-9e20-4c4f8b2c72b5 | - | - | - | - |
| click to load more citations click to collapse | ||||
Text-mined citations for rs267608327 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Jan 11, 2026
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.