Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001844.5(COL2A1):c.610-17_617del

Help
Interpretation:
Likely pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jul 30, 2021)
Last evaluated:
Jul 27, 2021
Accession:
VCV001185019.1
Variation ID:
1185019
Description:
25bp deletion
Help

NM_001844.5(COL2A1):c.610-17_617del

Allele ID
1174970
Variant type
Deletion
Variant length
25 bp
Cytogenetic location
12q13.11
Genomic location
12: 47995912-47995936 (GRCh38) GRCh38 UCSC
12: 48389695-48389719 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000012.11:g.48389698_48389722del
NC_000012.12:g.47995915_47995939del
NM_001844.5:c.610-17_617del MANE Select splice acceptor
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000012.12:47995911:ATGGGGCCCTGCATCGGAACAGAAAATG:ATG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely pathogenic 1 criteria provided, single submitter Jul 27, 2021 RCV001543669.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
COL2A1 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
1212 1223

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter More information
Likely pathogenic
(Jul 27, 2021)
criteria provided, single submitter
Method: clinical testing
Stickler syndrome type 1
Affected status: unknown
Allele origin: germline
Johns Hopkins Genomics, Johns Hopkins University
Accession: SCV001762356.1
Submitted: (Jul 30, 2021)
Comment:
COL2A1 c.610-17_617del is absent from a large population dataset and has not been reported in ClinVar nor the literature, to our knowledge. This variant deletes … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Aug 03, 2021